Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13539
Trapped Gene
1100001H23Rik (ENSMUSG00000030214)
Vector Insertion
Chr 6: 136560870 - 136561257
Public Clones CMHD-GT_291F11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313954 (Chr6:136561258..136561364 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCATCTGCTGTCGTGAGG Chr6:136561305..136561324 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313954 (Chr6:136561258..136561364 -)
Downstram Exon
ENSMUSE00000385446 (Chr6:136560592..136560869 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCATCTGCTGTCGTGAGG Chr6:136561305..136561324 59.85 55 GTTAAAAGGCGGGAGTCCAT Chr6:136560764..136560783 60.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347961 Chr6:136610083..136610366 CCCAAGCAGGCAAGACTAAT Chr6:136610341..136610360 59.34 50
upstream ENSMUSE00000196416 Chr6:136600252..136600471 TGTTTTTGGCTGGCTACCTC Chr6:136600272..136600291 60.25 50
upstream ENSMUSE00000196415 Chr6:136589652..136589735 TTCACGAACCTGTACCCACA Chr6:136589700..136589719 60 50
upstream ENSMUSE00000196414 Chr6:136588638..136588776 CAAAACATCAAAGCGCAGAA Chr6:136588735..136588754 59.99 40
upstream ENSMUSE00000196413 Chr6:136584013..136584153 GTTGGTGACCTGTTGGACCT Chr6:136584098..136584117 59.86 55
upstream ENSMUSE00000313975 Chr6:136582952..136583096 AAACGGCTGTCTTTCAGCAG Chr6:136582960..136582979 60.57 50
upstream ENSMUSE00000313969 Chr6:136565723..136565923 TCAGCAGTGGCCTGATATTG Chr6:136565871..136565890 59.82 50
upstream ENSMUSE00000313963 Chr6:136565448..136565588 CTCCGATCAAACCAATGTCC Chr6:136565457..136565476 60.32 50
upstream ENSMUSE00000313957 Chr6:136562313..136562498 GCTACCCTCTGCTGGTTCAC Chr6:136562425..136562444 59.87 60
upstream ENSMUSE00000313954 Chr6:136561258..136561364 TACCATCTGCTGTCGTGAGG Chr6:136561305..136561324 59.85 55

*** Putative Vector Insertion (Chr 6: 136560870 - 136561257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385446 Chr6:136560592..136560869 GTTAAAAGGCGGGAGTCCAT Chr6:136560764..136560783 60.32 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGGAGGATGCTATGACA Chr6:136561261..136561281 61.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAAGGAGTTAGGCCGTGA Chr6:136561201..136561221 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030214