Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13540
Trapped Gene
Plvap (ENSMUSG00000034845)
Vector Insertion
Chr 8: 74022305 - 74030569
Public Clones CMHD-GT_424G8-3 (cmhd) CMHD-GT_450B1-3 (cmhd) CMHD-GT_366A7-3 (cmhd) CMHD-GT_150B11-3 (cmhd)
CMHD-GT_406E12-3 (cmhd) CMHD-GT_138C2-3 (cmhd) CMHD-GT_395C2-3 (cmhd) CMHD-GT_300F9-3 (cmhd)
IST12263B7 (tigm) IST14930F12 (tigm) IST12263B7 (tigm) IST14277B3 (tigm)
IST12807A10 (tigm) IST12802B1 (tigm) IST10568H7 (tigm) IST10694A4 (tigm)
IST13992C5 (tigm) IST12125D8 (tigm) IST14118E9 (tigm) IST14522E4 (tigm)
Private Clones OST445253 (lexicon) OST393868 (lexicon) OST388730 (lexicon) OST358581 (lexicon)
OST340171 (lexicon) OST307678 (lexicon) OST299722 (lexicon) OST225943 (lexicon)
OST180894 (lexicon) OST129326 (lexicon) OST37836 (lexicon) OST30759 (lexicon)
OST18071 (lexicon) OST15769 (lexicon) OST13116 (lexicon) OST9452 (lexicon)
OST8198 (lexicon) OST6266 (lexicon) OST6094 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682485 (Chr8:74030570..74030573 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682485 (Chr8:74030570..74030573 -)
Downstram Exon
ENSMUSE00000395537 (Chr8:74021666..74022304 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCGGAACGCTCATCTACAAT Chr8:74021729..74021748 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000330923 Chr8:74035250..74035651 TCGTGTCGCTCATTCAGTTC Chr8:74035508..74035527 59.99 50
upstream ENSMUSE00000330913 Chr8:74032363..74032459 CAGGAACAGCTGAAGGAGGT Chr8:74032380..74032399 59.45 55
upstream ENSMUSE00000330904 Chr8:74031500..74032206 ACCCGTGAGAATGCAGAACT Chr8:74031768..74031787 59.73 50
upstream ENSMUSE00000330894 Chr8:74030919..74030976 No primer for this exon
upstream ENSMUSE00000330885 Chr8:74030736..74030817 TCCCTGTAGTCAACCCTGCT Chr8:74030747..74030766 59.72 55
upstream ENSMUSE00000682485 Chr8:74030570..74030573 No primer for this exon

*** Putative Vector Insertion (Chr 8: 74022305 - 74030569) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000395537 Chr8:74021666..74022304 CCGGAACGCTCATCTACAAT Chr8:74021729..74021748 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCACAAGGAGGCTGAGTA Chr8:74027516..74027536 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAGCGTGACTGGGAAAAC Chr8:74027503..74027523 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCTGGAGGATGGAGAGGAG Chr8:74024538..74024558 60.89 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TACTTGTGAGCTGGAGGATGG Chr8:74027545..74027566 60.26 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034845