Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13542
Trapped Gene
Carhsp1 (ENSMUSG00000008393)
Vector Insertion
Chr 16: 8664516 - 8672205
Public Clones E082D12 (ggtc) (ggtc) E082A11 (ggtc) (ggtc) E082C11 (ggtc) (ggtc)
E082B11 (ggtc) CMHD-GT_300D6-3 (cmhd) Ayu21-T273 (egtc) IST14169D11 (tigm)
Private Clones OST358583 (lexicon) OST307356 (lexicon) OST287284 (lexicon) OST246468 (lexicon)
OST220602 (lexicon) OST36666 (lexicon) OST35016 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000409484 (Chr16:8672206..8672248 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000409484 (Chr16:8672206..8672248 -)
Downstram Exon
ENSMUSE00000129745 (Chr16:8664348..8664515 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000409484 Chr16:8672206..8672248 No primer for this exon

*** Putative Vector Insertion (Chr 16: 8664516 - 8672205) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000129745 Chr16:8664348..8664515 No primer for this exon
downstream ENSMUSE00000563877 Chr16:8663680..8663802 No primer for this exon
downstream ENSMUSE00000129742 Chr16:8660790..8661196 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTTGCAGTCGAAGAGCA Chr16:8669233..8669253 59.86 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTTGCAGTCGAAGAGCA Chr16:8669233..8669253 59.86 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr16:8669178..8669198 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCTGGAGGAGTAGGACGTG Chr16:8669211..8669231 59.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008393