Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13547
Trapped Gene
Tmem49 (ENSMUSG00000018171)
Vector Insertion
Chr 11: 86400101 - 86415509
Public Clones CMHD-GT_537B10-5S (cmhd) CMHD-GT_300C8-3 (cmhd) CMHD-GT_475B8-3 (cmhd) CMHD-GT_537B10-3 (cmhd)
CMHD-GT_475D4-3 (cmhd) IST12230F8 (tigm) IST12846C2 (tigm) IST11747E5 (tigm)
IST13703C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105554 (Chr11:86415510..86415571 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105554 (Chr11:86415510..86415571 -)
Downstram Exon
ENSMUSE00000105558 (Chr11:86399998..86400100 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392078 Chr11:86497242..86497323 No primer for this exon
upstream ENSMUSE00000105552 Chr11:86479279..86479380 No primer for this exon
upstream ENSMUSE00000105551 Chr11:86478156..86478291 No primer for this exon
upstream ENSMUSE00000105557 Chr11:86476985..86477075 No primer for this exon
upstream ENSMUSE00000105555 Chr11:86474625..86474735 No primer for this exon
upstream ENSMUSE00000105549 Chr11:86457000..86457167 No primer for this exon
upstream ENSMUSE00000105547 Chr11:86448677..86448808 No primer for this exon
upstream ENSMUSE00000105546 Chr11:86424844..86424924 No primer for this exon
upstream ENSMUSE00000105556 Chr11:86420678..86420794 No primer for this exon
upstream ENSMUSE00000105554 Chr11:86415510..86415571 No primer for this exon

*** Putative Vector Insertion (Chr 11: 86400101 - 86415509) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105558 Chr11:86399998..86400100 No primer for this exon
downstream ENSMUSE00000363556 Chr11:86398198..86398953 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTTAATCGCCTTGCAGCAC Chr11:86400441..86400462 62.43 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCGTGACTGGGAAAACC Chr11:86400442..86400462 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAGGGAGGGCAGTTTCTTTT Chr11:86400536..86400556 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGGGAGGGCAGTTTCTTTT Chr11:86400536..86400556 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018171