Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1355
Trapped Gene
Uhmk1 (ENSMUSG00000026667)
Vector Insertion
Chr 1: 172138881 - 172141161
Public Clones CJ0546 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000161739 (Chr1:172141162..172141353 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCCTCGGAATCATTTTA Chr1:172141219..172141238 59.12 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000161739 (Chr1:172141162..172141353 -)
Downstram Exon
ENSMUSE00000161732 (Chr1:172138786..172138880 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCCTCGGAATCATTTTA Chr1:172141219..172141238 59.12 45 TGAGGTGATAGGCTGGAATTG Chr1:172138780..172138800 60.08 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302208 Chr1:172145104..172145524 No primer for this exon
upstream ENSMUSE00000161729 Chr1:172142367..172142659 CTACGTCCATGCAGACCTCA Chr1:172142450..172142469 59.85 55
upstream ENSMUSE00000161739 Chr1:172141162..172141353 GGAGCCTCGGAATCATTTTA Chr1:172141219..172141238 59.12 45

*** Putative Vector Insertion (Chr 1: 172138881 - 172141161) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000161732 Chr1:172138786..172138880 TGAGGTGATAGGCTGGAATTG Chr1:172138780..172138800 60.08 47.62
downstream ENSMUSE00000161738 Chr1:172137477..172137553 AAAGAATGGGCTGCACAATG Chr1:172137468..172137487 61.03 45
downstream ENSMUSE00000161736 Chr1:172137245..172137343 AGTCGGAAGCATCACCAGAT Chr1:172137287..172137306 59.69 50
downstream ENSMUSE00000161734 Chr1:172135246..172135334 TTGTCCTCTGCCAGGATTTT Chr1:172135224..172135243 59.67 45
downstream ENSMUSE00000593188 Chr1:172129388..172130144 AAATGGGTAAAGGGGTGCTC Chr1:172129882..172129901 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGATATAATCGCCTTGCAG Chr1:172141096..172141116 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGATACGTGACTGGGAAA Chr1:172141097..172141117 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026667