Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13554
Trapped Gene
Mrps6 (ENSMUSG00000039680)
Vector Insertion
Chr 16: 92099979 - 92111977
Public Clones CMHD-GT_515H12-3 (cmhd) CMHD-GT_152B2-3 (cmhd) CMHD-GT_390B10-3 (cmhd) CMHD-GT_300C4-3 (cmhd)
CMHD-GT_145D12-3 (cmhd) CMHD-GT_380C11-3 (cmhd) CMHD-GT_180H7-3 (cmhd) CMHD-GT_399C10-3 (cmhd)
Private Clones OST255945 (lexicon) OST67438 (lexicon) OST62541 (lexicon) OST59926 (lexicon)
OST29961 (lexicon) OST27987 (lexicon) OST27936 (lexicon) OST26144 (lexicon)
OST21339 (lexicon) OST20297 (lexicon) OST18314 (lexicon) OST12987 (lexicon)
OST7167 (lexicon) OST6677 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000247265 (Chr16:92099839..92099978 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCGAGGAGCCATAGTGAG Chr16:92099884..92099903 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000247265 (Chr16:92099839..92099978 +)
Downstram Exon
ENSMUSE00000367164 (Chr16:92111978..92112468 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCGAGGAGCCATAGTGAG Chr16:92099884..92099903 59.83 60 CAGCACTTGTCGGAGCATAA Chr16:92112018..92112037 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717233 Chr16:92058567..92058725 CGCTACGAGTTGGCTTTGAT Chr16:92058687..92058706 60.41 50
upstream ENSMUSE00000247265 Chr16:92099839..92099978 GACCGAGGAGCCATAGTGAG Chr16:92099884..92099903 59.83 60

*** Putative Vector Insertion (Chr 16: 92099979 - 92111977) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367164 Chr16:92111978..92112468 CAGCACTTGTCGGAGCATAA Chr16:92112018..92112037 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGGACTCATTTCCATGT Chr16:92111989..92112009 59.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGGACTCATTTCCATGT Chr16:92111989..92112009 59.78 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039680