Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13568
Trapped Gene
Mettl5 (ENSMUSG00000051730)
Vector Insertion
Chr 2: 69719006 - 69719353
Public Clones CMHD-GT_304E11-3 (cmhd) CMHD-GT_268F2-3 (cmhd)
Private Clones OST310077 (lexicon) OST59923 (lexicon) OST38422 (lexicon) OST37695 (lexicon)
OST37692 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000372008 (Chr2:69719354..69719468 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGAAAACAAAGCGGTTGC Chr2:69719411..69719430 60.12 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000372008 (Chr2:69719354..69719468 -)
Downstram Exon
ENSMUSE00000414234 (Chr2:69718824..69719005 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGAAAACAAAGCGGTTGC Chr2:69719411..69719430 60.12 40 GTCCCAAAGGGAGGATTCATA Chr2:69718816..69718836 60.14 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644731 Chr2:69723306..69723654 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000690970 Chr2:69723306..69723661 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000372008 Chr2:69719354..69719468 ATTGAAAACAAAGCGGTTGC Chr2:69719411..69719430 60.12 40

*** Putative Vector Insertion (Chr 2: 69719006 - 69719353) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000414234 Chr2:69718824..69719005 GTCCCAAAGGGAGGATTCATA Chr2:69718816..69718836 60.14 47.62
downstream ENSMUSE00000333101 Chr2:69717159..69717241 CCATTCCCAAAGCAGTCTTC Chr2:69717181..69717200 59.67 50
downstream ENSMUSE00000690969 Chr2:69715805..69717241 ACCCTCGGATGAGTGAGATG Chr2:69716770..69716789 60.07 55
downstream ENSMUSE00000690974 Chr2:69711941..69711992 TGACTTTCCATTCAGCAGCTT Chr2:69711937..69711957 60.01 42.86
downstream ENSMUSE00000690972 Chr2:69709789..69709838 No primer for this exon
downstream ENSMUSE00000690971 Chr2:69709271..69709373 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGTGAGTGGTCGTGTTTT Chr2:69719335..69719355 59.47 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAATGTCGTGACTGGGAAA Chr2:69719289..69719309 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051730