Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13573
Trapped Gene
Ick (ENSMUSG00000009828)
Vector Insertion
Chr 9: 78001544 - 78003155
Public Clones CMHD-GT_319A02-3 (cmhd) CMHD-GT_322B10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000271822 (Chr9:78001372..78001543 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000271822 (Chr9:78001372..78001543 +)
Downstram Exon
ENSMUSE00000271797 (Chr9:78003156..78003323 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718633 Chr9:77956999..77957288 No primer for this exon
upstream ENSMUSE00000710535 Chr9:77961107..77961262 No primer for this exon
upstream ENSMUSE00000717105 Chr9:77961122..77961262 No primer for this exon
upstream ENSMUSE00000271954 Chr9:77979102..77979378 No primer for this exon
upstream ENSMUSE00000718273 Chr9:77979102..77979378 No primer for this exon
upstream ENSMUSE00000271937 Chr9:77983403..77983457 No primer for this exon
upstream ENSMUSE00000271907 Chr9:77987783..77987904 No primer for this exon
upstream ENSMUSE00000271877 Chr9:77989001..77989080 No primer for this exon
upstream ENSMUSE00000531636 Chr9:77998336..77998468 No primer for this exon
upstream ENSMUSE00000271822 Chr9:78001372..78001543 No primer for this exon

*** Putative Vector Insertion (Chr 9: 78001544 - 78003155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271797 Chr9:78003156..78003323 No primer for this exon
downstream ENSMUSE00000271778 Chr9:78005448..78005759 No primer for this exon
downstream ENSMUSE00000271746 Chr9:78008176..78008366 No primer for this exon
downstream ENSMUSE00000271723 Chr9:78008470..78008618 No primer for this exon
downstream ENSMUSE00000531625 Chr9:78012338..78012466 No primer for this exon
downstream ENSMUSE00000714696 Chr9:78012338..78013220 No primer for this exon
downstream ENSMUSE00000271684 Chr9:78014717..78014839 No primer for this exon
downstream ENSMUSE00000404025 Chr9:78015407..78015745 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGTGTTGGGAACACCAAA Chr9:78001521..78001541 59.44 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGTGTTGGGAACACCAAA Chr9:78001521..78001541 59.44 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009828