Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13575
Trapped Gene
Clic1 (ENSMUSG00000007041)
Vector Insertion
Chr 17: 35192354 - 35195274
Public Clones CMHD-GT_307C09-3 (cmhd) CMHD-GT_319G04-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000141727 (Chr17:35192172..35192353 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000141727 (Chr17:35192172..35192353 +)
Downstram Exon
ENSMUSE00000336518 (Chr17:35195275..35195665 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657459 Chr17:35187377..35187431 No primer for this exon
upstream ENSMUSE00000280443 Chr17:35189380..35189489 No primer for this exon
upstream ENSMUSE00000141732 Chr17:35189726..35189851 No primer for this exon
upstream ENSMUSE00000141728 Chr17:35189978..35190084 No primer for this exon
upstream ENSMUSE00000141727 Chr17:35192172..35192353 No primer for this exon

*** Putative Vector Insertion (Chr 17: 35192354 - 35195274) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336518 Chr17:35195275..35195665 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGCCAAAGCTTCACATA Chr17:35192329..35192349 60.54 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGCCAAAGCTTCACATA Chr17:35192329..35192349 60.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007041