Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13584
Trapped Gene
Arid3b (ENSMUSG00000004661)
Vector Insertion
Chr 9: 57681422 - 57682040
Public Clones CMHD-GT_305F02-3 (cmhd) CMHD-GT_402D4-3 (cmhd) CMHD-GT_282C01-3 (cmhd)
Private Clones OST289950 (lexicon) OST251904 (lexicon) OST116647 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444631 (Chr9:57681423..57682043 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444631 (Chr9:57681423..57682043 -)
Downstram Exon
ENSMUSE00000478601 (Chr9:57681423..57682039 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698368 Chr9:57684489..57684600 No primer for this exon
upstream ENSMUSE00000444631 Chr9:57681423..57682043 No primer for this exon
upstream ENSMUSE00000478601 Chr9:57681423..57682039 No primer for this exon

*** Putative Vector Insertion (Chr 9: 57681422 - 57682040) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464653 Chr9:57658216..57658287 No primer for this exon
downstream ENSMUSE00000218667 Chr9:57657972..57658044 No primer for this exon
downstream ENSMUSE00000534120 Chr9:57657968..57658044 No primer for this exon
downstream ENSMUSE00000636512 Chr9:57653238..57653346 No primer for this exon
downstream ENSMUSE00000486564 Chr9:57645849..57646032 No primer for this exon
downstream ENSMUSE00000636511 Chr9:57645849..57646032 No primer for this exon
downstream ENSMUSE00000484441 Chr9:57644279..57644595 No primer for this exon
downstream ENSMUSE00000636510 Chr9:57644279..57644595 No primer for this exon
downstream ENSMUSE00000467845 Chr9:57643914..57644159 No primer for this exon
downstream ENSMUSE00000636508 Chr9:57643914..57644159 No primer for this exon
downstream ENSMUSE00000465630 Chr9:57642743..57642841 No primer for this exon
downstream ENSMUSE00000636507 Chr9:57642494..57642841 No primer for this exon
downstream ENSMUSE00000698353 Chr9:57640323..57640492 No primer for this exon
downstream ENSMUSE00000464736 Chr9:57638320..57640492 No primer for this exon
downstream ENSMUSE00000476350 Chr9:57638269..57638422 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGAGAGCCATGCCAGTCT Chr9:57681989..57682009 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGAGAGCCATGCCAGTCT Chr9:57681989..57682009 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004661