Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13591
Trapped Gene
Tmem108 (ENSMUSG00000042757)
Vector Insertion
Chr 9: 103655298 - 103664084
Public Clones CMHD-GT_287F10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634725 (Chr9:103664085..103664132 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634725 (Chr9:103664085..103664132 -)
Downstram Exon
ENSMUSE00000634724 (Chr9:103655185..103655297 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACCACACGCTTACTTCTGC Chr9:103655233..103655252 59.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634725 Chr9:103664085..103664132 No primer for this exon

*** Putative Vector Insertion (Chr 9: 103655298 - 103664084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634724 Chr9:103655185..103655297 CACCACACGCTTACTTCTGC Chr9:103655233..103655252 59.51 55
downstream ENSMUSE00000634723 Chr9:103512041..103512126 GGCAATAGAGGGCCTGTAAA Chr9:103512028..103512047 59.18 50
downstream ENSMUSE00000503630 Chr9:103401132..103402538 GCTGAGACAGTGGCATCAAA Chr9:103401451..103401470 59.99 50
downstream ENSMUSE00000318056 Chr9:103391519..103391673 CCATTGTGATGGCATTGTTC Chr9:103391559..103391578 59.78 45
downstream ENSMUSE00000530513 Chr9:103386108..103387113 GGAACCTCTACATGCCCAGA Chr9:103386694..103386713 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATACTAAGGGACCCCAGCTC Chr9:103661098..103661119 59.97 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCGTGACTGGGAAAACC Chr9:103661017..103661037 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042757