Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13612
Trapped Gene
Bbs2 (ENSMUSG00000031755)
Vector Insertion
Chr 8: 96592283 - 96593861
Public Clones CMHD-GT_398C10-3 (cmhd) CMHD-GT_266D4-3 (cmhd) CMHD-GT_438A3-3 (cmhd) CMHD-GT_136E1-3 (cmhd)
CMHD-GT_438B3-3 (cmhd) PSTVUpb21e1 (vanderbilt) IST12405C6 (tigm)
Private Clones OST375579 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212719 (Chr8:96593862..96594010 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACCAAGCAATCCAAAGA Chr8:96593878..96593897 59.25 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212719 (Chr8:96593862..96594010 -)
Downstram Exon
ENSMUSE00000298659 (Chr8:96591854..96592282 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACCAAGCAATCCAAAGA Chr8:96593878..96593897 59.25 40 CCGGAGTGCTTTGTCCTTAG Chr8:96592017..96592036 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362772 Chr8:96622136..96622711 GCAGGCGTAGAGAGAGTTGG Chr8:96622423..96622442 60.16 60
upstream ENSMUSE00000298759 Chr8:96616295..96616522 AACCCTGAGCTTGGCTATGA Chr8:96616371..96616390 59.84 50
upstream ENSMUSE00000212708 Chr8:96613662..96613787 ATCGGTGGAAACTGTGCTCT Chr8:96613702..96613721 59.73 50
upstream ENSMUSE00000212721 Chr8:96613003..96613065 ACTTTGACGGTGATGGGAAG Chr8:96613009..96613028 59.97 50
upstream ENSMUSE00000212730 Chr8:96611277..96611354 TTGTGGCAGAAATGACAGAGA Chr8:96611282..96611302 59.43 42.86
upstream ENSMUSE00000212704 Chr8:96610731..96610835 ATGGCAGTCGGTTTGGTTAC Chr8:96610791..96610810 59.86 50
upstream ENSMUSE00000212702 Chr8:96610556..96610642 TGAACTGATAACCGGGTGGT Chr8:96610567..96610586 60.23 50
upstream ENSMUSE00000212705 Chr8:96606256..96606391 TGGATGGCCACGTACAGTTA Chr8:96606281..96606300 59.99 50
upstream ENSMUSE00000212710 Chr8:96605898..96606037 GACCTGATCCGAGAGCTGAG Chr8:96605953..96605972 60.1 60
upstream ENSMUSE00000212703 Chr8:96604925..96605069 AGGCATTTCCACTTCCAATG Chr8:96604925..96604944 59.93 45
upstream ENSMUSE00000212718 Chr8:96604668..96604839 GAGGGAATTTTTGTGGGTGA Chr8:96604788..96604807 59.77 45
upstream ENSMUSE00000298687 Chr8:96603383..96603512 ATGCATTGACAAGCCCAGAT Chr8:96603440..96603459 60.49 45
upstream ENSMUSE00000212728 Chr8:96600852..96600983 TTCAGAATTCCCCGTTTCAC Chr8:96600915..96600934 59.91 45
upstream ENSMUSE00000212712 Chr8:96599023..96599160 CGAGGAACTACGGAAAGTGC Chr8:96599031..96599050 59.88 55
upstream ENSMUSE00000212731 Chr8:96598192..96598304 CTCATCCGAAGTTTGCTGGT Chr8:96598225..96598244 60.26 50
upstream ENSMUSE00000212719 Chr8:96593862..96594010 TGAACCAAGCAATCCAAAGA Chr8:96593878..96593897 59.25 40

*** Putative Vector Insertion (Chr 8: 96592283 - 96593861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000298659 Chr8:96591854..96592282 CCGGAGTGCTTTGTCCTTAG Chr8:96592017..96592036 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCCTGGTACCTGATTTGC Chr8:96593832..96593852 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCCTGGTACCTGATTTGC Chr8:96593832..96593852 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGCTTGTTGAGTGTTGATGC Chr8:96594032..96594052 59.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCTTGTTGAGTGTTGATGC Chr8:96594032..96594052 59.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031755