Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13623
Trapped Gene
Ihpk1 (ENSMUSG00000032594)
Vector Insertion
Chr 9: 107905154 - 107926433
Public Clones (sanger) (sanger) (sanger) E059A02 (ggtc) (ggtc) D119A02 (ggtc)
D026E10 (ggtc) CMHD-GT_266E9-3 (cmhd) PST17484-NL (escells) IST15061E4 (tigm)
IST14185C6 (tigm) IST13606H4 (tigm) IST14169D4 (tigm)
Private Clones OST301633 (lexicon) OST278503 (lexicon) OST247240 (lexicon) OST230456 (lexicon)
OST134847 (lexicon) OST31987 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453497 (Chr9:107904920..107905153 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTTGATCCGTACCCAGTG Chr9:107904977..107904996 59.42 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453497 (Chr9:107904920..107905153 +)
Downstram Exon
ENSMUSE00000344323 (Chr9:107926434..107926781 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTTGATCCGTACCCAGTG Chr9:107904977..107904996 59.42 50 GAGGCCAATGGTCACAGTCT Chr9:107926476..107926495 60.12 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453497 Chr9:107904920..107905153 TTGTTGATCCGTACCCAGTG Chr9:107904977..107904996 59.42 50

*** Putative Vector Insertion (Chr 9: 107905154 - 107926433) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000344323 Chr9:107926434..107926781 GAGGCCAATGGTCACAGTCT Chr9:107926476..107926495 60.12 55
downstream ENSMUSE00000221280 Chr9:107934330..107934540 CGCTCTGGTGTGTCATCTTG Chr9:107934438..107934457 60.46 55
downstream ENSMUSE00000221277 Chr9:107943236..107943417 GAGCTCAGACCGCTATTGCT Chr9:107943328..107943347 59.75 55
downstream ENSMUSE00000248020 Chr9:107947056..107947231 CAGCACACAGGGGTACTTGA Chr9:107947111..107947130 59.74 55
downstream ENSMUSE00000248006 Chr9:107947794..107951111 GGTCCCAAATTGATGATTGG Chr9:107950449..107950468 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAATCGCCTTGCAGCAC Chr9:107917202..107917222 62.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTCGTGACTGGGAAAACC Chr9:107917201..107917221 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032594