Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13624
Trapped Gene
Cdc42bpg (ENSMUSG00000024769)
Vector Insertion
Chr 19: 6322148 - 6322253
Public Clones CMHD-GT_252B11-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000232610 (Chr19:6322027..6322147 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTCTTCTTCCGGGTGTCTG Chr19:6322103..6322122 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000232610 (Chr19:6322027..6322147 +)
Downstram Exon
ENSMUSE00000232589 (Chr19:6322254..6322371 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTCTTCTTCCGGGTGTCTG Chr19:6322103..6322122 60.22 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643852 Chr19:6306716..6306875 No primer for this exon
upstream ENSMUSE00000643850 Chr19:6309126..6309217 TCTTGAAGGTGATTGGCAGA Chr19:6309183..6309202 59.37 45
upstream ENSMUSE00000643849 Chr19:6309299..6309382 TGCATAAGTGGGAGATGCTG Chr19:6309351..6309370 59.82 50
upstream ENSMUSE00000643848 Chr19:6309727..6309822 CTACGCCTTCCAGGATGAAG Chr19:6309795..6309814 59.83 55
upstream ENSMUSE00000643847 Chr19:6310218..6310366 GTTCTGGCCATCCACTCACT Chr19:6310323..6310342 60.12 55
upstream ENSMUSE00000643846 Chr19:6310795..6310888 CCTGCGTCTCAACAACAATG Chr19:6310864..6310883 60.3 50
upstream ENSMUSE00000643845 Chr19:6311022..6311222 ACTGGTGGTCACTGGGAGTC Chr19:6311119..6311138 60.01 60
upstream ENSMUSE00000643844 Chr19:6311322..6311570 ATGATACCCTCAACCGTCCA Chr19:6311551..6311570 60.19 50
upstream ENSMUSE00000643843 Chr19:6312118..6312197 GCCATTTGTTGGCTTCACTTA Chr19:6312165..6312185 60.12 42.86
upstream ENSMUSE00000643842 Chr19:6313219..6313316 GAGCTCAGCCACAAGTGTCA Chr19:6313295..6313314 60.19 55
upstream ENSMUSE00000643841 Chr19:6313415..6313495 TGCGGCTTCAGAAGGAAGTA Chr19:6313451..6313470 61.04 50
upstream ENSMUSE00000643839 Chr19:6313689..6313795 GATGGCCTCCATGCTAGAAG Chr19:6313727..6313746 59.8 55
upstream ENSMUSE00000643838 Chr19:6313891..6314070 ACTGAAGCTCAGGCAGCATT Chr19:6313897..6313916 60.16 50
upstream ENSMUSE00000643837 Chr19:6314285..6314365 GGCTCCAGGGACAATGTAAA Chr19:6314325..6314344 59.93 50
upstream ENSMUSE00000643836 Chr19:6314496..6314617 TGAGACGAACGGCATAGGAT Chr19:6314513..6314532 60.62 50
upstream ENSMUSE00000643835 Chr19:6314705..6314780 GTGTTGGGAAAGAGGAGGTTC Chr19:6314710..6314730 59.97 52.38
upstream ENSMUSE00000643833 Chr19:6314990..6315096 GGGAGACTGAGAGCAACTGG Chr19:6315048..6315067 59.99 60
upstream ENSMUSE00000233249 Chr19:6315172..6315286 GCAGGCCTTGGCTACTAAGA Chr19:6315205..6315224 59.62 55
upstream ENSMUSE00000233221 Chr19:6315639..6315787 AGCACTGGAAGCTGAGATCC Chr19:6315704..6315723 59.56 55
upstream ENSMUSE00000233190 Chr19:6315864..6315952 GGCTGAGAAGCAAAGTCAGG Chr19:6315876..6315895 60.13 55
upstream ENSMUSE00000421163 Chr19:6316199..6316251 CCTCATCCCTCTCCTGTCCT Chr19:6316218..6316237 60.6 60
upstream ENSMUSE00000421159 Chr19:6316341..6316439 AGGAGAGGGTCCAAGGTCTG Chr19:6316370..6316389 60.64 60
upstream ENSMUSE00000232661 Chr19:6316519..6316578 CCGAAGGTCCTCCTGCTAAG Chr19:6316559..6316578 61.26 60
upstream ENSMUSE00000233123 Chr19:6316829..6316934 TCCATCCCCTACCAAGTGTC Chr19:6316861..6316880 59.78 55
upstream ENSMUSE00000233104 Chr19:6317161..6317294 ACTGCCTATGAGGGCTTCCT Chr19:6317271..6317290 60.23 55
upstream ENSMUSE00000233083 Chr19:6317375..6317514 GCCTGTTGTTGTTTGATGCT Chr19:6317439..6317458 58.78 45
upstream ENSMUSE00000233057 Chr19:6317604..6317685 AGGACCTGCCACGTATCTTC Chr19:6317663..6317682 59.17 55
upstream ENSMUSE00000233030 Chr19:6318358..6318574 CGACCGGTGTACACACTCAA Chr19:6318496..6318515 60.63 55
upstream ENSMUSE00000233007 Chr19:6320079..6320141 AGGGGTTGTTTGTGATCCAT Chr19:6320109..6320128 59.12 45
upstream ENSMUSE00000232981 Chr19:6320243..6320842 CAGGCACCTTCGCTCTCTAC Chr19:6320603..6320622 60.16 60
upstream ENSMUSE00000232959 Chr19:6321657..6321754 GAAAACGCCCTTGATGTGTT Chr19:6321689..6321708 59.98 45
upstream ENSMUSE00000232625 Chr19:6321827..6321911 TCCTTTATGGCACCGAGAAG Chr19:6321858..6321877 60.21 50
upstream ENSMUSE00000232610 Chr19:6322027..6322147 TTTCTTCTTCCGGGTGTCTG Chr19:6322103..6322122 60.22 50

*** Putative Vector Insertion (Chr 19: 6322148 - 6322253) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000232589 Chr19:6322254..6322371 No primer for this exon
downstream ENSMUSE00000421108 Chr19:6322555..6322678 TTCTCCAGGGAGACCATCAC Chr19:6322671..6322690 60.05 55
downstream ENSMUSE00000421105 Chr19:6322793..6322881 TGATTCGCTGGACAGAGATG Chr19:6322836..6322855 59.94 50
downstream ENSMUSE00000417160 Chr19:6324517..6325650 AGTTCTCGGGTTTGGGTTCT Chr19:6325236..6325255 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTGGGTGGGACTTTCTAT Chr19:6322175..6322195 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTGGGTGGGACTTTCTAT Chr19:6322175..6322195 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024769