Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13636
Trapped Gene
Ihpk1 (ENSMUSG00000032594)
Vector Insertion
Chr 9: 107926782 - 107934329
Public Clones (sanger) E076G12 (ggtc) CMHD-GT_264A9-3 (cmhd)
Private Clones OST244539 (lexicon) OST243234 (lexicon) OST137568 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000344323 (Chr9:107926434..107926781 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAACAGCGCTTCTACGAGT Chr9:107926720..107926739 59.64 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000344323 (Chr9:107926434..107926781 +)
Downstram Exon
ENSMUSE00000221280 (Chr9:107934330..107934540 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAACAGCGCTTCTACGAGT Chr9:107926720..107926739 59.64 55 CGCTCTGGTGTGTCATCTTG Chr9:107934438..107934457 60.46 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453497 Chr9:107904920..107905153 TTGTTGATCCGTACCCAGTG Chr9:107904977..107904996 59.42 50
upstream ENSMUSE00000344323 Chr9:107926434..107926781 GGAACAGCGCTTCTACGAGT Chr9:107926720..107926739 59.64 55

*** Putative Vector Insertion (Chr 9: 107926782 - 107934329) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221280 Chr9:107934330..107934540 CGCTCTGGTGTGTCATCTTG Chr9:107934438..107934457 60.46 55
downstream ENSMUSE00000221277 Chr9:107943236..107943417 GAGCTCAGACCGCTATTGCT Chr9:107943328..107943347 59.75 55
downstream ENSMUSE00000248020 Chr9:107947056..107947231 CAGCACACAGGGGTACTTGA Chr9:107947111..107947130 59.74 55
downstream ENSMUSE00000248006 Chr9:107947794..107951111 GGTCCCAAATTGATGATTGG Chr9:107950449..107950468 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGTCTATGGTGGGGTCAG Chr9:107932779..107932799 59.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTCTATGGTGGGGTCAG Chr9:107932779..107932799 59.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032594