Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13642
Trapped Gene
E2f1 (ENSMUSG00000027490)
Vector Insertion
Chr 2: 154390245 - 154394802
Public Clones CMHD-GT_294C7-3 (cmhd)
Private Clones OST376235 (lexicon) OST190536 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681269 (Chr2:154394803..154394913 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGTGGGGCTGATATTTGA Chr2:154394867..154394886 60.15 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681269 (Chr2:154394803..154394913 -)
Downstram Exon
ENSMUSE00000170063 (Chr2:154390154..154390244 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGTGGGGCTGATATTTGA Chr2:154394867..154394886 60.15 45 TGCTACCAGCGAGGTACTGA Chr2:154390171..154390190 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331544 Chr2:154395225..154395588 TCGCAGATCGTCATCATCTC Chr2:154395367..154395386 59.91 50
upstream ENSMUSE00000554888 Chr2:154394803..154395456 TCGCAGATCGTCATCATCTC Chr2:154395367..154395386 59.91 50
upstream ENSMUSE00000681269 Chr2:154394803..154394913 ATGGTGGGGCTGATATTTGA Chr2:154394867..154394886 60.15 45

*** Putative Vector Insertion (Chr 2: 154390245 - 154394802) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170063 Chr2:154390154..154390244 TGCTACCAGCGAGGTACTGA Chr2:154390171..154390190 59.62 55
downstream ENSMUSE00000170061 Chr2:154389631..154389850 AAGAAGCGTTTGGTGGTCAG Chr2:154389762..154389781 60.29 50
downstream ENSMUSE00000661392 Chr2:154388674..154388826 GAGTCCTCCGAAAGCAGTTG Chr2:154388664..154388683 59.99 55
downstream ENSMUSE00000170067 Chr2:154388673..154388826 GAGTCCTCCGAAAGCAGTTG Chr2:154388664..154388683 59.99 55
downstream ENSMUSE00000170064 Chr2:154387083..154387196 CCATCTGTTCTGCAGGGTCT Chr2:154387117..154387136 60.26 55
downstream ENSMUSE00000661391 Chr2:154387083..154387197 No primer for this exon
downstream ENSMUSE00000343918 Chr2:154386767..154386986 TAATCCCGTCTGCACTCTCC Chr2:154386886..154386905 60.22 55
downstream ENSMUSE00000706138 Chr2:154385374..154386671 TCTCCAGACACCCTGAATCC Chr2:154386371..154386390 60.05 55
downstream ENSMUSE00000377029 Chr2:154385370..154386671 TCTCCAGACACCCTGAATCC Chr2:154386371..154386390 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTCGGTGGAGGTGGTAG Chr2:154391794..154391814 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCTCGGTGGAGGTGGTAG Chr2:154391794..154391814 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027490