Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13655
Trapped Gene
Lsm4 (ENSMUSG00000031848)
Vector Insertion
Chr 8: 73197357 - 73200453
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) 3SE078E11 (ggtc) 3SD070C07 (ggtc)
3SM123C08 (ggtc) 5SE078E11 (ggtc) (ggtc) CMHD-GT_22B5-3 (cmhd) (cmhd)
CMHD-GT_300G9-3 (cmhd) PST25756-NR (escells) PST22199-NR (escells) PST6094-NL (escells)
PST25696-NR (escells) PST23887-NR (escells) IST14528H4 (tigm) IST11536F6 (tigm)
IST12275E12 (tigm) IST14272G7 (tigm) IST13207E12 (tigm) IST14579A3 (tigm)
IST14310A4 (tigm) IST15078G1 (tigm) IST14563A7 (tigm) IST13517B12 (tigm)
Private Clones OST440474 (lexicon) OST440454 (lexicon) OST405629 (lexicon) OST401418 (lexicon)
OST328068 (lexicon) OST296397 (lexicon) OST270371 (lexicon) OST205197 (lexicon)
OST175461 (lexicon) OST121604 (lexicon) OST76534 (lexicon) OST75056 (lexicon)
OST52751 (lexicon) OST34730 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682766 (Chr8:73197278..73197356 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTATCGCTGCAGGGAAGATG Chr8:73197337..73197356 61.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682766 (Chr8:73197278..73197356 +)
Downstram Exon
ENSMUSE00000225998 (Chr8:73200454..73200495 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTATCGCTGCAGGGAAGATG Chr8:73197337..73197356 61.27 50 CTGTCTTCAGCAGCGACAAG Chr8:73200481..73200500 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682766 Chr8:73197278..73197356 TTATCGCTGCAGGGAAGATG Chr8:73197337..73197356 61.27 50

*** Putative Vector Insertion (Chr 8: 73197357 - 73200453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000225998 Chr8:73200454..73200495 CTGTCTTCAGCAGCGACAAG Chr8:73200481..73200500 59.92 55
downstream ENSMUSE00000213763 Chr8:73201677..73201775 CAGATGCCCGTTGTAGGTCT Chr8:73201721..73201740 60.13 55
downstream ENSMUSE00000213764 Chr8:73201853..73202033 CGCACCATGTCAATGATCTC Chr8:73201950..73201969 60.08 50
downstream ENSMUSE00000636306 Chr8:73202259..73202642 AAGTGGGGCTTCACACAAAG Chr8:73202424..73202443 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGTGGCTCACATCTGTA Chr8:73200315..73200335 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGTGGCTCACATCTGTA Chr8:73200315..73200335 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031848