Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13656
Trapped Gene
Cgnl1 (ENSMUSG00000032232)
Vector Insertion
Chr 9: 71572284 - 71573890
Public Clones CMHD-GT_297D6-3 (cmhd)
Private Clones OST449154 (lexicon) OST347978 (lexicon) OST257961 (lexicon) OST212032 (lexicon)
OST210147 (lexicon) OST208933 (lexicon) OST193918 (lexicon) OST181547 (lexicon)
OST134784 (lexicon) OST127016 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217972 (Chr9:71572285..71573889 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACGCAAAGAAGCATCAC Chr9:71573368..71573387 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217972 (Chr9:71572285..71573889 -)
Downstram Exon
ENSMUSE00000709060 (Chr9:71572285..71573889 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACGCAAAGAAGCATCAC Chr9:71573368..71573387 59.99 45 GTGATGCTTCTTTGCGTTCA Chr9:71573346..71573365 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418515 Chr9:71619316..71619409 No primer for this exon
upstream ENSMUSE00000711561 Chr9:71618839..71619367 AGACGAGTCGGACAGTTGGT Chr9:71619096..71619115 59.76 55
upstream ENSMUSE00000217972 Chr9:71572285..71573889 TGAACGCAAAGAAGCATCAC Chr9:71573368..71573387 59.99 45
upstream ENSMUSE00000709060 Chr9:71572285..71573889 TGAACGCAAAGAAGCATCAC Chr9:71573368..71573387 59.99 45

*** Putative Vector Insertion (Chr 9: 71572284 - 71573890) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635665 Chr9:71571341..71571435 CCTCGTTCGTTTGTTGTGTG Chr9:71571359..71571378 60.19 50
downstream ENSMUSE00000635662 Chr9:71569403..71569508 CTTTTGGTGGCATCCTCATT Chr9:71569457..71569476 59.93 45
downstream ENSMUSE00000635660 Chr9:71565203..71565304 CTGTTGCCTTCAGAGGGAGA Chr9:71565254..71565273 60.52 55
downstream ENSMUSE00000635658 Chr9:71564215..71564363 CTCGCTCCTCCTTGATGTTC Chr9:71564314..71564333 59.95 55
downstream ENSMUSE00000635655 Chr9:71563130..71563265 TCACGCTCCATCTTCACTTG Chr9:71563217..71563236 59.98 50
downstream ENSMUSE00000532099 Chr9:71552955..71553167 TCCTGTTCCTCTTTGGCAAT Chr9:71553087..71553106 59.67 45
downstream ENSMUSE00000635651 Chr9:71503853..71504059 TTCGGAGTGTCTCCTTTGCT Chr9:71503839..71503858 59.99 50
downstream ENSMUSE00000635648 Chr9:71503100..71503204 CCTCCAGCTGCTGTACTTCAC Chr9:71503161..71503181 60.07 57.14
downstream ENSMUSE00000635647 Chr9:71499041..71499193 CTCGATGGTCTTGTCCAGGT Chr9:71499034..71499053 60.11 55
downstream ENSMUSE00000635645 Chr9:71498029..71498199 TTATACTCGCCCAGCTGCTT Chr9:71498110..71498129 60 50
downstream ENSMUSE00000635644 Chr9:71493299..71493460 GCCTCCAGCTCATACTCCAG Chr9:71493326..71493345 59.97 60
downstream ENSMUSE00000635643 Chr9:71489166..71489255 AGCAAGTCAGCGTTGGTTCT Chr9:71489175..71489194 60.06 50
downstream ENSMUSE00000635642 Chr9:71480405..71480488 AGAAGCTCGCTCCTCATCTG Chr9:71480441..71480460 59.85 55
downstream ENSMUSE00000635641 Chr9:71479538..71479662 AGGTGGATAATCCGGCTCTT Chr9:71479609..71479628 59.92 50
downstream ENSMUSE00000635638 Chr9:71478669..71478777 CATCACCAGCTCCTTCACCT Chr9:71478692..71478711 60.26 55
downstream ENSMUSE00000217984 Chr9:71478283..71478446 CTTTCCAGTCGGTCGATCTC Chr9:71478354..71478373 59.8 55
downstream ENSMUSE00000710565 Chr9:71477018..71477199 CTCAGTGGGGCTTCGTAGAG Chr9:71477088..71477107 60.01 60
downstream ENSMUSE00000338221 Chr9:71474316..71477199 CTCAGTGGGGCTTCGTAGAG Chr9:71477088..71477107 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGTATTTTGGCGAATACCA Chr9:71573847..71573868 59.98 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTGGGACAGAGAACCAT Chr9:71573871..71573891 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032232