Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13658
Trapped Gene
Dppa5a (ENSMUSG00000060461)
Vector Insertion
Chr 9: 78215711 - 78215791
Public Clones CMHD-GT_285E1-3 (cmhd)
Private Clones OST329164 (lexicon) OST244473 (lexicon) OST187769 (lexicon) OST168333 (lexicon)
OST135685 (lexicon) OST130935 (lexicon) OST67373 (lexicon) OST60916 (lexicon)
OST58672 (lexicon) OST45181 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517407 (Chr9:78215792..78215965 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGATGGTGACCCTCGTGAC Chr9:78215887..78215906 60.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517407 (Chr9:78215792..78215965 -)
Downstram Exon
ENSMUSE00000516414 (Chr9:78215528..78215710 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGATGGTGACCCTCGTGAC Chr9:78215887..78215906 60.82 55 TCACCTGCTCGATGTGAGAC Chr9:78215650..78215669 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517407 Chr9:78215792..78215965 ATGATGGTGACCCTCGTGAC Chr9:78215887..78215906 60.82 55

*** Putative Vector Insertion (Chr 9: 78215711 - 78215791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000516414 Chr9:78215528..78215710 TCACCTGCTCGATGTGAGAC Chr9:78215650..78215669 59.99 55
downstream ENSMUSE00000388301 Chr9:78214864..78215101 ATCCAGGTCGGAGACACAAG Chr9:78214986..78215005 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTCGCTGGTGCTGAAATA Chr9:78215798..78215818 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTCGCTGGTGCTGAAATA Chr9:78215798..78215818 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060461