Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13667
Trapped Gene
Ptms (ENSMUSG00000030122)
Vector Insertion
Chr 6: 124865008 - 124867577
Public Clones (sanger) (sanger) CMHD-GT_272H1-3 (cmhd) IST11635D5 (tigm)
Private Clones OST286636 (lexicon) OST282629 (lexicon) OST264508 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000651454 (Chr6:124867578..124867964 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000651454 (Chr6:124867578..124867964 -)
Downstram Exon
ENSMUSE00000195495 (Chr6:124864936..124865007 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTCCTCCACCTTGTCCTTC Chr6:124864952..124864971 59.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000651454 Chr6:124867578..124867964 No primer for this exon
upstream ENSMUSE00000718585 Chr6:124867578..124867964 No primer for this exon

*** Putative Vector Insertion (Chr 6: 124865008 - 124867577) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000195495 Chr6:124864936..124865007 TCTCCTCCACCTTGTCCTTC Chr6:124864952..124864971 59.23 55
downstream ENSMUSE00000195494 Chr6:124864653..124864731 CATCCCCTTCATCATCATCC Chr6:124864637..124864656 60.1 50
downstream ENSMUSE00000195499 Chr6:124864426..124864484 GCCTTCATCCTCCTCCTCTT Chr6:124864434..124864453 59.78 55
downstream ENSMUSE00000691709 Chr6:124864426..124864487 GCCTTCATCCTCCTCCTCTT Chr6:124864434..124864453 59.78 55
downstream ENSMUSE00000691708 Chr6:124863701..124864250 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60
downstream ENSMUSE00000651453 Chr6:124863699..124864250 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAGCTGAGTGCCAAGGTA Chr6:124867573..124867593 63.75 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAGCTGAGTGCCAAGGTA Chr6:124867573..124867593 63.75 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAAGGACAAGGTGGAGGAGA Chr6:124864972..124864992 59.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAGGACAAGGTGGAGGAGA Chr6:124864972..124864992 59.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030122