Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13682
Trapped Gene
AC142244.11 (ENSMUSG00000026558)
Vector Insertion
Chr 1: 169167780 - 169214906
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (ggtc) (ggtc) (ggtc) (ggtc) CMHD-GT_285H12-3 (cmhd) FHCRC-GT-S21-3C1 (fhcrc)
IST15079C4 (tigm) IST13666F6 (tigm) IST15103H5 (tigm)
Private Clones OST462085 (lexicon) OST442773 (lexicon) OST424959 (lexicon) OST422386 (lexicon)
OST418510 (lexicon) OST416013 (lexicon) OST412564 (lexicon) OST401401 (lexicon)
OST392522 (lexicon) OST371634 (lexicon) OST366907 (lexicon) OST357700 (lexicon)
OST341557 (lexicon) OST315786 (lexicon) OST300206 (lexicon) OST292774 (lexicon)
OST285516 (lexicon) OST284122 (lexicon) OST259313 (lexicon) OST252153 (lexicon)
OST238237 (lexicon) OST187033 (lexicon) OST167695 (lexicon) OST149093 (lexicon)
OST142470 (lexicon) OST138989 (lexicon) OST130028 (lexicon) OST108815 (lexicon)
OST65879 (lexicon) OST60117 (lexicon) OST54969 (lexicon) OST47111 (lexicon)
OST47107 (lexicon) OST45364 (lexicon) OST21738 (lexicon) OST7824 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224798 (Chr1:169214907..169215192 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224798 (Chr1:169214907..169215192 -)
Downstram Exon
ENSMUSE00000160510 (Chr1:169167620..169167779 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTCAGGATCACCACCTGCTT Chr1:169167678..169167697 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224798 Chr1:169214907..169215192 No primer for this exon

*** Putative Vector Insertion (Chr 1: 169167780 - 169214906) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000160510 Chr1:169167620..169167779 CTCAGGATCACCACCTGCTT Chr1:169167678..169167697 60.26 55
downstream ENSMUSE00000160512 Chr1:169166734..169166830 AAGTCGTACACGGGGATCTG Chr1:169166727..169166746 59.99 55
downstream ENSMUSE00000160516 Chr1:169164823..169164965 TGGTGACCGTCTCCTCTTTC Chr1:169164924..169164943 60.24 55
downstream ENSMUSE00000160515 Chr1:169160024..169160121 CTCCCTCTTTCGCTGATGTC Chr1:169160072..169160091 59.95 55
downstream ENSMUSE00000160514 Chr1:169157863..169157911 GATTGTCGGCACCTCTAGGA Chr1:169157844..169157863 60.22 55
downstream ENSMUSE00000359419 Chr1:169156219..169156652 GGGGTGTAGCCGTTGAGATA Chr1:169156537..169156556 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAACCACTGAGCCATCCAG Chr1:169184921..169184941 58.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACTGTGTGGTCTCCAACTT Chr1:169184919..169184941 59.66 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CACACCTGTCCTTTCCCATC Chr1:169197160..169197180 60.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACACCTGTCCTTTCCCATC Chr1:169197160..169197180 60.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026558