Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13695
Trapped Gene
OTTMUSG00000003947 (ENSMUSG00000075410)
Vector Insertion
Chr 11: 116520691 - 116521078
Public Clones CMHD-GT_263E12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669682 (Chr11:116520612..116520690 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669682 (Chr11:116520612..116520690 +)
Downstram Exon
ENSMUSE00000705776 (Chr11:116521079..116521096 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714145 Chr11:116514848..116515291 TCTCCGAGCTAGAAGGCATC Chr11:116514910..116514929 59.68 55
upstream ENSMUSE00000720642 Chr11:116514848..116515291 TCTCCGAGCTAGAAGGCATC Chr11:116514910..116514929 59.68 55
upstream ENSMUSE00000669684 Chr11:116518436..116518621 CTTCTTCAGCGGAGTTGGTC Chr11:116518505..116518524 59.99 55
upstream ENSMUSE00000669683 Chr11:116518852..116518920 CGGCTCAGACACAGACCTTC Chr11:116518888..116518907 61.01 60
upstream ENSMUSE00000669689 Chr11:116518852..116518920 CGGCTCAGACACAGACCTTC Chr11:116518888..116518907 61.01 60
upstream ENSMUSE00000669682 Chr11:116520612..116520690 No primer for this exon
upstream ENSMUSE00000669688 Chr11:116520612..116520690 No primer for this exon

*** Putative Vector Insertion (Chr 11: 116520691 - 116521078) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645982 Chr11:116521047..116521141 ACCGTTTCTCCCGTTTTCTT Chr11:116521134..116521153 59.98 45
downstream ENSMUSE00000669687 Chr11:116521047..116521141 ACCGTTTCTCCCGTTTTCTT Chr11:116521134..116521153 59.98 45
downstream ENSMUSE00000705776 Chr11:116521079..116521096 No primer for this exon
downstream ENSMUSE00000645981 Chr11:116521099..116521141 ACCGTTTCTCCCGTTTTCTT Chr11:116521134..116521153 59.98 45
downstream ENSMUSE00000645980 Chr11:116529346..116529701 ATGGTAGAGACGCGATGCTT Chr11:116529439..116529458 59.87 50
downstream ENSMUSE00000669686 Chr11:116529346..116529701 ATGGTAGAGACGCGATGCTT Chr11:116529439..116529458 59.87 50
downstream ENSMUSE00000705775 Chr11:116529346..116529605 ATGGTAGAGACGCGATGCTT Chr11:116529439..116529458 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGCGCTATGGAGTTTAG Chr11:116520704..116520724 59.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGCGCTATGGAGTTTAG Chr11:116520704..116520724 59.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075410