Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13708
Trapped Gene
Tcf12 (ENSMUSG00000032228)
Vector Insertion
Chr 9: 71733096 - 71743736
Public Clones CMHD-GT_265B2-3 (cmhd) PST4665-NR (escells) IST11632B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000421924 (Chr9:71743737..71743805 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000421924 (Chr9:71743737..71743805 -)
Downstram Exon
ENSMUSE00000421919 (Chr9:71732990..71733095 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCACGGTTGAAATCGTCAGA Chr9:71733033..71733052 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496456 Chr9:71959383..71959426 TTAATCGGGAAGGTTGGATG Chr9:71959400..71959419 59.76 45
upstream ENSMUSE00000498545 Chr9:71958545..71958641 TGAAGATGAATCCCCAGCAG Chr9:71958605..71958624 61.15 50
upstream ENSMUSE00000490829 Chr9:71957483..71957555 GGGAAAACGAGACCAACAAC Chr9:71957512..71957531 59.43 50
upstream ENSMUSE00000217941 Chr9:71863445..71863518 ACCAAGCCCCTCCTATGATT Chr9:71863453..71863472 59.79 50
upstream ENSMUSE00000217951 Chr9:71848223..71848325 TCGATTAGGAACCCACGAAG Chr9:71848262..71848281 60.07 50
upstream ENSMUSE00000217939 Chr9:71791761..71791825 TCTGGACTCTCAGGCTGTCA Chr9:71791762..71791781 59.69 55
upstream ENSMUSE00000217949 Chr9:71770459..71770594 AGAAGAAGACCGCTCCATGA Chr9:71770473..71770492 59.95 50
upstream ENSMUSE00000217934 Chr9:71764812..71764864 CCTCCTGGCCTACCTTCTTC Chr9:71764813..71764832 60.2 60
upstream ENSMUSE00000421924 Chr9:71743737..71743805 No primer for this exon

*** Putative Vector Insertion (Chr 9: 71733096 - 71743736) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000421919 Chr9:71732990..71733095 TCACGGTTGAAATCGTCAGA Chr9:71733033..71733052 60.24 45
downstream ENSMUSE00000217946 Chr9:71731463..71731602 CATCCCATTCGATGAACTCC Chr9:71731534..71731553 60.28 50
downstream ENSMUSE00000217932 Chr9:71730914..71731058 GACATTGGCGGAAGACTTGT Chr9:71730978..71730997 60.12 50
downstream ENSMUSE00000217945 Chr9:71730524..71730588 ATCACCCGTCTGTGAGCTTC Chr9:71730526..71730545 60.27 55
downstream ENSMUSE00000313165 Chr9:71723796..71723874 AGGAGATCCCACTGGTGTTG Chr9:71723787..71723806 59.96 55
downstream ENSMUSE00000313141 Chr9:71717881..71717954 TTGGAGATGAAGGAGCTTGC Chr9:71717885..71717904 60.48 50
downstream ENSMUSE00000217919 Chr9:71716806..71716877 TCTTGCAAATGCTCGTGAAG Chr9:71716815..71716834 60.13 45
downstream ENSMUSE00000217953 Chr9:71715879..71716085 GAAGGTCCAACTGCATGGTT Chr9:71715987..71716006 59.97 50
downstream ENSMUSE00000217937 Chr9:71706647..71706761 AGACAGGACCGAATGATTGC Chr9:71706683..71706702 60.08 50
downstream ENSMUSE00000217948 Chr9:71706291..71706453 TGCCCCTAGATGAGACCTTG Chr9:71706276..71706295 60.21 55
downstream ENSMUSE00000217928 Chr9:71704112..71704344 GCTCTCTGGCATTGTTAGCC Chr9:71704237..71704256 59.99 55
downstream ENSMUSE00000358913 Chr9:71697579..71697732 CAGATGACCCATAGGGTTGG Chr9:71697571..71697590 60.19 55
downstream ENSMUSE00000399521 Chr9:71693560..71694367 GTGCTGACCAGTTGCTTTGA Chr9:71694181..71694200 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGCTGCTTTTCATATTCC Chr9:71737714..71737734 60.04 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCTGCTTTTCATATTCC Chr9:71737714..71737734 60.04 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTCTGCCTCCTTTCAGTCA Chr9:71737818..71737838 59.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAATCGTGACTGGGAAAACC Chr9:71737739..71737759 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032228