Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13711
Trapped Gene
Spats1 (ENSMUSG00000023935)
Vector Insertion
Chr 17: 45598260 - 45601375
Public Clones (sanger) (sanger) CMHD-GT_268C1-3 (cmhd) IST11481F11 (tigm) IST13897G1 (tigm)
IST13865C2 (tigm) IST11481F11 (tigm) IST12718A12 (tigm) IST11523G6 (tigm)
IST13865C2 (tigm)
Private Clones OST451839 (lexicon) OST394651 (lexicon) OST130726 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696132 (Chr17:45601376..45601529 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCAGCCTCTCGTCTTCTG Chr17:45601437..45601456 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696132 (Chr17:45601376..45601529 -)
Downstram Exon
ENSMUSE00000657303 (Chr17:45598111..45598259 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCAGCCTCTCGTCTTCTG Chr17:45601437..45601456 60.13 60 GCGAAACTTTTGAGGAACGA Chr17:45598149..45598168 60.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696133 Chr17:45611748..45611893 GCATCCTGGTATTTGGCAGT Chr17:45611804..45611823 59.96 50
upstream ENSMUSE00000696141 Chr17:45603643..45603655 No primer for this exon
upstream ENSMUSE00000696132 Chr17:45601376..45601529 GACCAGCCTCTCGTCTTCTG Chr17:45601437..45601456 60.13 60
upstream ENSMUSE00000696140 Chr17:45601376..45601532 GACCAGCCTCTCGTCTTCTG Chr17:45601437..45601456 60.13 60

*** Putative Vector Insertion (Chr 17: 45598260 - 45601375) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657303 Chr17:45598111..45598259 GCGAAACTTTTGAGGAACGA Chr17:45598149..45598168 60.37 45
downstream ENSMUSE00000657302 Chr17:45594107..45594268 GGATGTTGCTGCTGAACCTT Chr17:45594193..45594212 60.26 50
downstream ENSMUSE00000657301 Chr17:45591040..45591160 GGATTATCCCCTGGTGTCAA Chr17:45591090..45591109 59.6 50
downstream ENSMUSE00000657300 Chr17:45589627..45589689 TTTTGGAAGTGGCTCAAGTG Chr17:45589613..45589632 58.9 45
downstream ENSMUSE00000657299 Chr17:45586384..45586499 CTGCCAGTTGTCAAGCTCCT Chr17:45586399..45586418 60.59 55
downstream ENSMUSE00000657297 Chr17:45585886..45586140 GTGTTCAACAAGGCCAAACA Chr17:45585934..45585953 59.59 45
downstream ENSMUSE00000657298 Chr17:45582830..45583032 ATGAGAGGATGTCCGGTGAG Chr17:45582856..45582875 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAACGTGACTGGGAAAACC Chr17:45598308..45598328 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 2 TAATCGCCTTGCAGCACATC Chr17:45598459..45598479 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 AACAGCGTGACTGGGAAAAC Chr17:45598464..45598484 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023935