Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13715
Trapped Gene
Pold2 (ENSMUSG00000020471)
Vector Insertion
Chr 11: 5776993 - 5778194
Public Clones (sanger) (sanger) CMHD-GT_267G9-3 (cmhd) IST10230A3 (tigm) IST11710H5 (tigm)
Private Clones OST348381 (lexicon) OST241590 (lexicon) OST240126 (lexicon) OST186404 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000663017 (Chr11:5778195..5778226 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000663017 (Chr11:5778195..5778226 -)
Downstram Exon
ENSMUSE00000663016 (Chr11:5776716..5776992 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000663017 Chr11:5778195..5778226 No primer for this exon

*** Putative Vector Insertion (Chr 11: 5776993 - 5778194) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000663016 Chr11:5776716..5776992 No primer for this exon
downstream ENSMUSE00000663015 Chr11:5775057..5775178 No primer for this exon
downstream ENSMUSE00000105120 Chr11:5774764..5774887 No primer for this exon
downstream ENSMUSE00000105123 Chr11:5774318..5774432 No primer for this exon
downstream ENSMUSE00000105118 Chr11:5774027..5774225 No primer for this exon
downstream ENSMUSE00000105125 Chr11:5773692..5773772 No primer for this exon
downstream ENSMUSE00000263759 Chr11:5773412..5773569 No primer for this exon
downstream ENSMUSE00000263752 Chr11:5773030..5773157 No primer for this exon
downstream ENSMUSE00000105126 Chr11:5772673..5772774 No primer for this exon
downstream ENSMUSE00000105121 Chr11:5772194..5772421 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGGGTCAGACTTGGCTA Chr11:5778141..5778161 60.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAACGTGGGTCCTGGGTCAG Chr11:5778150..5778170 63.24 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAGTAATCGCCTTGCAGCAC Chr11:5778159..5778179 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGAGCGTGACTGGGAAAAC Chr11:5778161..5778181 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020471