Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13736
Trapped Gene
1810010H24Rik (ENSMUSG00000078607)
Vector Insertion
Chr 11: 106889872 - 106890898
Public Clones CMHD-GT_524D9-5S (cmhd) CMHD-GT_482A7-3 (cmhd) CMHD-GT_255G4-3 (cmhd) CMHD-GT_234H7-3 (cmhd)
CMHD-GT_269H3-3 (cmhd) CMHD-GT_517D9-5S (cmhd) CMHD-GT_517D9-3 (cmhd)
Private Clones OST451771 (lexicon) OST447667 (lexicon) OST357343 (lexicon) OST307621 (lexicon)
OST277431 (lexicon) OST266645 (lexicon) OST251007 (lexicon) OST199968 (lexicon)
OST179417 (lexicon) OST115658 (lexicon) OST103564 (lexicon) OST74657 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000671091 (Chr11:106889677..106889871 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATAAGCCGTGTCCAGAAT Chr11:106889843..106889862 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000671091 (Chr11:106889677..106889871 +)
Downstram Exon
ENSMUSE00000671090 (Chr11:106890899..106891268 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATAAGCCGTGTCCAGAAT Chr11:106889843..106889862 59.96 50 GCACACGGAGTCCATAAGGT Chr11:106891167..106891186 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000671091 Chr11:106889677..106889871 CCATAAGCCGTGTCCAGAAT Chr11:106889843..106889862 59.96 50

*** Putative Vector Insertion (Chr 11: 106889872 - 106890898) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000671090 Chr11:106890899..106891268 GCACACGGAGTCCATAAGGT Chr11:106891167..106891186 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAAGGCCATTCATCGTGTC Chr11:106889894..106889914 59.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAGGCCATTCATCGTGTC Chr11:106889894..106889914 59.94 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078607