Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13748
Trapped Gene
Bag1 (ENSMUSG00000028416)
Vector Insertion
Chr 4: 40886218 - 40888557
Public Clones CMHD-GT_258D5-3 (cmhd) CMHD-GT_258C04-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178976 (Chr4:40888558..40888671 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTAACCACCTGCAAGAATTG Chr4:40888585..40888605 59.76 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178976 (Chr4:40888558..40888671 -)
Downstram Exon
ENSMUSE00000178973 (Chr4:40886110..40886217 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTAACCACCTGCAAGAATTG Chr4:40888585..40888605 59.76 47.62 CTCCGCTTGCAATTCCTTAG Chr4:40886166..40886185 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374349 Chr4:40894755..40895264 ACCCGTAGCAAGAACGTGAC Chr4:40894919..40894938 60.18 55
upstream ENSMUSE00000675538 Chr4:40894755..40895314 ACCCGTAGCAAGAACGTGAC Chr4:40894919..40894938 60.18 55
upstream ENSMUSE00000178971 Chr4:40893202..40893330 CCCCACAGCAAGGTAACAGT Chr4:40893284..40893303 60.03 55
upstream ENSMUSE00000178972 Chr4:40890658..40890740 AACACCGTTGTCAGCACTTG Chr4:40890699..40890718 59.79 50
upstream ENSMUSE00000178976 Chr4:40888558..40888671 GCTAACCACCTGCAAGAATTG Chr4:40888585..40888605 59.76 47.62

*** Putative Vector Insertion (Chr 4: 40886218 - 40888557) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178973 Chr4:40886110..40886217 CTCCGCTTGCAATTCCTTAG Chr4:40886166..40886185 59.97 50
downstream ENSMUSE00000297199 Chr4:40884165..40884227 No primer for this exon
downstream ENSMUSE00000376996 Chr4:40883452..40883709 TGGAGAAACAGGCGACTTCT Chr4:40883514..40883533 59.99 50
downstream ENSMUSE00000675536 Chr4:40883431..40883709 TGGAGAAACAGGCGACTTCT Chr4:40883514..40883533 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGTTGCCTGGTTGTAATCG Chr4:40888500..40888521 59.88 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000028416