Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13749
Trapped Gene
Ngp (ENSMUSG00000032484)
Vector Insertion
Chr 9: 110322543 - 110323316
Public Clones CMHD-GT_452C5-3 (cmhd) CMHD-GT_429H7-3 (cmhd) CMHD-GT_461B11-3 (cmhd) CMHD-GT_453B2-3 (cmhd)
CMHD-GT_452D6-3 (cmhd) CMHD-GT_258A2-3 (cmhd) CMHD-GT_476H8-3 (cmhd)
Private Clones OST472910 (lexicon) OST425305 (lexicon) OST423229 (lexicon) OST423228 (lexicon)
OST277543 (lexicon) OST23933 (lexicon) OST21900 (lexicon) OST13417 (lexicon)
OST6741 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220032 (Chr9:110322359..110322542 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTCCGCCTTCTAGTCAG Chr9:110322523..110322542 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220032 (Chr9:110322359..110322542 +)
Downstram Exon
ENSMUSE00000220031 (Chr9:110323317..110323418 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTCCGCCTTCTAGTCAG Chr9:110322523..110322542 60.01 60 TCCAGGAAGTCGCAGTCTTT Chr9:110323414..110323433 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220032 Chr9:110322359..110322542 CCACTCCGCCTTCTAGTCAG Chr9:110322523..110322542 60.01 60

*** Putative Vector Insertion (Chr 9: 110322543 - 110323316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220031 Chr9:110323317..110323418 TCCAGGAAGTCGCAGTCTTT Chr9:110323414..110323433 59.99 50
downstream ENSMUSE00000220034 Chr9:110324200..110324286 TCCCTGTGCAATTTCTCTCC Chr9:110324224..110324243 60.19 50
downstream ENSMUSE00000512367 Chr9:110324776..110325514 ATCCCCATTAAGGGATCTGG Chr9:110325445..110325464 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATTCCAATCTGGAAAAC Chr9:110322554..110322574 59.37 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCACGTTTCTCTTCGTGAC Chr9:110322580..110322600 60.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032484