Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1375
Trapped Gene
Atp6v1d (ENSMUSG00000021114)
Vector Insertion
Chr 12: 79953332 - 79958213
Public Clones CJ0222 (sanger)
Private Clones OST71499 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000114748 (Chr12:79958214..79958331 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000114748 (Chr12:79958214..79958331 -)
Downstram Exon
ENSMUSE00000114752 (Chr12:79953252..79953331 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346413 Chr12:79962406..79962513 No primer for this exon
upstream ENSMUSE00000114748 Chr12:79958214..79958331 No primer for this exon

*** Putative Vector Insertion (Chr 12: 79953332 - 79958213) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000114752 Chr12:79953252..79953331 No primer for this exon
downstream ENSMUSE00000114750 Chr12:79951459..79951526 No primer for this exon
downstream ENSMUSE00000114749 Chr12:79950727..79950771 No primer for this exon
downstream ENSMUSE00000114753 Chr12:79949383..79949486 No primer for this exon
downstream ENSMUSE00000114751 Chr12:79948754..79948820 No primer for this exon
downstream ENSMUSE00000114754 Chr12:79946213..79946291 No primer for this exon
downstream ENSMUSE00000653839 Chr12:79943976..79944597 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGTAGAGCCCACCTTACTT Chr12:79955216..79955237 60.01 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTAGAGCCCACCTTACTT Chr12:79955216..79955237 60.01 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021114