Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13751
Trapped Gene
Crisp1 (ENSMUSG00000025431)
Vector Insertion
Chr 17: 40445923 - 40449953
Public Clones CMHD-GT_255A4-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000492207 (Chr17:40449954..40450027 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTTCTTCTTGGCTGCTG Chr17:40449989..40450008 61.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000492207 (Chr17:40449954..40450027 -)
Downstram Exon
ENSMUSE00000494291 (Chr17:40445806..40445922 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTTCTTCTTGGCTGCTG Chr17:40449989..40450008 61.26 55 TTCGTCTCAATTGGTTGTGC Chr17:40445819..40445838 59.7 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000348004 Chr17:40456104..40456156 No primer for this exon
upstream ENSMUSE00000492207 Chr17:40449954..40450027 GCTGTTCTTCTTGGCTGCTG Chr17:40449989..40450008 61.26 55

*** Putative Vector Insertion (Chr 17: 40445923 - 40449953) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494291 Chr17:40445806..40445922 TTCGTCTCAATTGGTTGTGC Chr17:40445819..40445838 59.7 45
downstream ENSMUSE00000466054 Chr17:40444641..40444728 ACACTTGTCTGCCCATTGCT Chr17:40444656..40444675 60.72 50
downstream ENSMUSE00000150790 Chr17:40442011..40442156 TCCTTGGATTGCAGAAGACC Chr17:40442067..40442086 60.19 50
downstream ENSMUSE00000150787 Chr17:40438272..40438366 CAACTCCACATGCAACTTGG Chr17:40438305..40438324 60.15 50
downstream ENSMUSE00000150788 Chr17:40435103..40435191 TGCATAGCCCATCTTCACAG Chr17:40435081..40435100 59.82 50
downstream ENSMUSE00000388485 Chr17:40430710..40431460 AGGCATGTAGCTTTGCAACC Chr17:40431333..40431352 60.28 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATTCATTGTAATCGCCTTG Chr17:40446891..40446912 60.47 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGCGTGACTGGGAAAACC Chr17:40446886..40446906 62.2 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025431