Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13754
Trapped Gene
Pipox (ENSMUSG00000017453)
Vector Insertion
Chr 11: 77697495 - 77705613
Public Clones (sanger) (sanger) D074E05 (ggtc) D065H06 (ggtc) CMHD-GT_539F6-3 (cmhd)
CMHD-GT_539F6-5S (cmhd) CMHD-GT_265F12-3 (cmhd) CMHD-GT_539F6-3S (cmhd) FHCRC-GT-S10-10F1 (fhcrc)
IST10458C1 (tigm) IST14905A7 (tigm) IST14601D8 (tigm) IST14347H6 (tigm)
IST13132G2 (tigm) IST11048G8 (tigm) IST12778G10 (tigm) IST11089C10 (tigm)
IST10526C4 (tigm) IST15023H9 (tigm) IST15034D1 (tigm) IST15051B9 (tigm)
IST12070A9 (tigm) IST12949D10 (tigm) IST13193H12 (tigm) IST13800H9 (tigm)
IST13191H12 (tigm) IST13808G1 (tigm) IST10464E10 (tigm) IST11074F9 (tigm)
IST13808G1 (tigm) IST12070A9 (tigm) IST15051B8 (tigm) IST14434B4 (tigm)
IST11732F5 (tigm) IST10013E11 (tigm) IST13193H12 (tigm) IST13197H12 (tigm)
IST14937E9 (tigm) IST12745C12 (tigm) IST11002G9 (tigm) IST13800H9 (tigm)
IST10458A2 (tigm) IST10458C1 (tigm) IST11089C10 (tigm) IST12896C7 (tigm)
IST11076G10 (tigm) IST11667F6 (tigm) IST11002G9 (tigm)
Private Clones OST471697 (lexicon) OST448199 (lexicon) OST392153 (lexicon) OST368890 (lexicon)
OST365106 (lexicon) OST315070 (lexicon) OST311297 (lexicon) OST281483 (lexicon)
OST256568 (lexicon) OST211577 (lexicon) OST200655 (lexicon) OST166763 (lexicon)
OST131811 (lexicon) OST124474 (lexicon) OST123873 (lexicon) OST114132 (lexicon)
OST82974 (lexicon) OST49045 (lexicon) OST39916 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110149 (Chr11:77705614..77705762 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110149 (Chr11:77705614..77705762 -)
Downstram Exon
ENSMUSE00000110150 (Chr11:77697281..77697494 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000110147 Chr11:77707169..77707288 No primer for this exon
upstream ENSMUSE00000110149 Chr11:77705614..77705762 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77697495 - 77705613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110150 Chr11:77697281..77697494 No primer for this exon
downstream ENSMUSE00000110146 Chr11:77696631..77696813 No primer for this exon
downstream ENSMUSE00000110151 Chr11:77696119..77696265 No primer for this exon
downstream ENSMUSE00000110148 Chr11:77695620..77695778 No primer for this exon
downstream ENSMUSE00000110145 Chr11:77695003..77695078 No primer for this exon
downstream ENSMUSE00000337637 Chr11:77694206..77694756 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGAGAAGGCAAACTAAGC Chr11:77705575..77705595 59.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGAGAAGGCAAACTAAGC Chr11:77705575..77705595 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGACAGAGCCGCATAATAA Chr11:77705709..77705729 59.28 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TACATTCGGCAGAACCCATT Chr11:77705792..77705812 60.33 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017453