Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13757
Trapped Gene
Fuca1 (ENSMUSG00000028673)
Vector Insertion
Chr 4: 135481602 - 135485813
Public Clones CMHD-GT_403G10-3 (cmhd) CMHD-GT_517B2-3 (cmhd) CMHD-GT_265F7-3 (cmhd) (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000181220 (Chr4:135481464..135481601 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATACGCTACGGCCTCTACCA Chr4:135481468..135481487 59.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000181220 (Chr4:135481464..135481601 +)
Downstram Exon
ENSMUSE00000181225 (Chr4:135485814..135485919 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATACGCTACGGCCTCTACCA Chr4:135481468..135481487 59.75 55 CCAGATCAGGTCAGGCTTGT Chr4:135485838..135485857 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000262007 Chr4:135476674..135477065 ATCAGTGGGCCGAACTCTTT Chr4:135477029..135477048 61.02 50
upstream ENSMUSE00000400130 Chr4:135478882..135479016 ACTGGAACTCGAAGGACGTG Chr4:135478947..135478966 60.3 55
upstream ENSMUSE00000181220 Chr4:135481464..135481601 ATACGCTACGGCCTCTACCA Chr4:135481468..135481487 59.75 55

*** Putative Vector Insertion (Chr 4: 135481602 - 135485813) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000181225 Chr4:135485814..135485919 CCAGATCAGGTCAGGCTTGT Chr4:135485838..135485857 60.26 55
downstream ENSMUSE00000181219 Chr4:135488814..135489014 CCCACCGGTCATTCACTATC Chr4:135488844..135488863 60.19 55
downstream ENSMUSE00000181227 Chr4:135490605..135490795 CCTCCCAAACTTACCGTCTG Chr4:135490636..135490655 59.59 55
downstream ENSMUSE00000181221 Chr4:135492838..135492937 GGCGTAAACAGTTGCGTTTT Chr4:135492871..135492890 60.17 45
downstream ENSMUSE00000341316 Chr4:135494989..135495203 AGAGTCCACGCAAACTCCAC Chr4:135495110..135495129 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTCGTCAGGGCAAAAACA Chr4:135481554..135481574 60.48 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTCGTCAGGGCAAAAACA Chr4:135481554..135481574 60.48 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028673