Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13761
Trapped Gene
Nr6a1 (ENSMUSG00000063972)
Vector Insertion
Chr 2: 38615956 - 38617788
Public Clones CMHD-GT_465D8-3 (cmhd) CMHD-GT_268D4-3 (cmhd)
Private Clones OST448590 (lexicon) OST365201 (lexicon) OST320408 (lexicon) OST147283 (lexicon)
OST57753 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693504 (Chr2:38617789..38617798 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693504 (Chr2:38617789..38617798 -)
Downstram Exon
ENSMUSE00000693503 (Chr2:38615707..38615955 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTTCGTTGTTCAGCTCGAT Chr2:38615893..38615912 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693506 Chr2:38783106..38783208 TTCGATACGGCCCATTAGAG Chr2:38783143..38783162 60.05 50
upstream ENSMUSE00000645525 Chr2:38781638..38781737 No primer for this exon
upstream ENSMUSE00000693496 Chr2:38781638..38781940 ACTACGAAGGCGCAAGTCAT Chr2:38781779..38781798 59.9 50
upstream ENSMUSE00000693505 Chr2:38781638..38782023 ACTACGAAGGCGCAAGTCAT Chr2:38781779..38781798 59.9 50
upstream ENSMUSE00000361887 Chr2:38740716..38740757 GAATTGGCAGAGCTTGATCC Chr2:38740724..38740743 59.78 50
upstream ENSMUSE00000439314 Chr2:38728115..38728159 No primer for this exon
upstream ENSMUSE00000693504 Chr2:38617789..38617798 No primer for this exon

*** Putative Vector Insertion (Chr 2: 38615956 - 38617788) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162399 Chr2:38615707..38615949 TGTTGCAAATGCTCCTCTTG Chr2:38615799..38615818 59.99 45
downstream ENSMUSE00000693503 Chr2:38615707..38615955 GGTTCGTTGTTCAGCTCGAT Chr2:38615893..38615912 60.26 50
downstream ENSMUSE00000162393 Chr2:38604356..38604411 TGGACTGGTCCAATGCTCTT Chr2:38604335..38604354 60.66 50
downstream ENSMUSE00000162401 Chr2:38598327..38598481 CATGGTTGCTCCAGTGATTG Chr2:38598384..38598403 60.11 50
downstream ENSMUSE00000714423 Chr2:38595900..38596127 ATCCCTGAATGCCATGAATC Chr2:38596066..38596085 59.72 45
downstream ENSMUSE00000717033 Chr2:38595900..38596127 ATCCCTGAATGCCATGAATC Chr2:38596066..38596085 59.72 45
downstream ENSMUSE00000693493 Chr2:38594407..38594661 GCTTCTTGATCCAGGCAATC Chr2:38594551..38594570 59.78 50
downstream ENSMUSE00000711441 Chr2:38594407..38594661 GCTTCTTGATCCAGGCAATC Chr2:38594551..38594570 59.78 50
downstream ENSMUSE00000711939 Chr2:38594407..38594661 GCTTCTTGATCCAGGCAATC Chr2:38594551..38594570 59.78 50
downstream ENSMUSE00000162402 Chr2:38586566..38586687 TTCATGCATGCGTACTCCTC Chr2:38586567..38586586 59.83 50
downstream ENSMUSE00000693500 Chr2:38586566..38586687 TTCATGCATGCGTACTCCTC Chr2:38586567..38586586 59.83 50
downstream ENSMUSE00000162396 Chr2:38585003..38585155 GTATCGGATCTCTGGCAAGC Chr2:38584988..38585007 59.8 55
downstream ENSMUSE00000693499 Chr2:38585003..38585155 GTATCGGATCTCTGGCAAGC Chr2:38584988..38585007 59.8 55
downstream ENSMUSE00000693497 Chr2:38582434..38583435 GGCTTGTGGGATGAGATGAT Chr2:38582737..38582756 59.89 50
downstream ENSMUSE00000603271 Chr2:38578890..38583435 ACATTAAAGGCGGTCCACAG Chr2:38581077..38581096 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:38617717..38617737 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000063972