Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13763
Trapped Gene
Mypn (ENSMUSG00000020067)
Vector Insertion
Chr 10: 62632179 - 62655134
Public Clones (sanger) CMHD-GT_268G7-3 (cmhd) CMHD-GT_452B3-3 (cmhd) CMHD-GT_534H12-5S (cmhd)
CMHD-GT_534H12-3 (cmhd) PST13878-NR (escells) IST12522H7 (tigm) IST12762H5 (tigm)
IST12681A12 (tigm) IST12357B2 (tigm) IST10318A12 (tigm) IST11747H2 (tigm)
IST13331E1 (tigm) IST12322H5 (tigm) IST11760H3 (tigm) IST14758E2 (tigm)
IST12032D12 (tigm) IST11753E3 (tigm) IST11824E9 (tigm) IST12259D4 (tigm)
IST12297A3 (tigm) IST12522H7 (tigm) IST11101A7 (tigm) IST12304D7 (tigm)
IST13025D2 (tigm) IST12205H8HMR1 (tigm) IST12801E6 (tigm) IST11617F9 (tigm)
IST10318A12 (tigm) IST12399A4 (tigm) IST11746F12 (tigm) IST11395D8 (tigm)
Private Clones OST450195 (lexicon) OST417962 (lexicon) OST411828 (lexicon) OST394723 (lexicon)
OST353225 (lexicon) OST349014 (lexicon) OST316710 (lexicon) OST298008 (lexicon)
OST290832 (lexicon) OST245063 (lexicon) OST182102 (lexicon) OST155079 (lexicon)
OST98813 (lexicon) OST84423 (lexicon) OST36496 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000612418 (Chr10:62655135..62656031 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000612418 (Chr10:62655135..62656031 -)
Downstram Exon
ENSMUSE00000420052 (Chr10:62632003..62632178 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612419 Chr10:62666466..62666700 No primer for this exon
upstream ENSMUSE00000612418 Chr10:62655135..62656031 No primer for this exon

*** Putative Vector Insertion (Chr 10: 62632179 - 62655134) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000420052 Chr10:62632003..62632178 No primer for this exon
downstream ENSMUSE00000100285 Chr10:62629981..62630032 No primer for this exon
downstream ENSMUSE00000100290 Chr10:62626261..62626372 No primer for this exon
downstream ENSMUSE00000100288 Chr10:62624970..62625041 No primer for this exon
downstream ENSMUSE00000612399 Chr10:62615543..62615684 No primer for this exon
downstream ENSMUSE00000642939 Chr10:62612771..62612794 No primer for this exon
downstream ENSMUSE00000612398 Chr10:62610625..62610741 No primer for this exon
downstream ENSMUSE00000100295 Chr10:62608584..62608956 No primer for this exon
downstream ENSMUSE00000612417 Chr10:62598456..62599043 No primer for this exon
downstream ENSMUSE00000612397 Chr10:62597681..62597819 No primer for this exon
downstream ENSMUSE00000612396 Chr10:62593731..62593952 No primer for this exon
downstream ENSMUSE00000612402 Chr10:62590376..62590525 No primer for this exon
downstream ENSMUSE00000100278 Chr10:62588417..62588496 No primer for this exon
downstream ENSMUSE00000100286 Chr10:62586019..62586145 No primer for this exon
downstream ENSMUSE00000100292 Chr10:62584650..62584857 No primer for this exon
downstream ENSMUSE00000100281 Chr10:62582777..62582942 No primer for this exon
downstream ENSMUSE00000100296 Chr10:62581169..62581302 No primer for this exon
downstream ENSMUSE00000411135 Chr10:62578543..62579774 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAATTCTGTTTGCCATGA Chr10:62649087..62649107 59.28 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAATTCTGTTTGCCATGA Chr10:62649087..62649107 59.28 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCATGCTTTGCTTCCAACAT Chr10:62632042..62632062 59.28 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCATGCTTTGCTTCCAACAT Chr10:62632042..62632062 59.28 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020067