Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13766
Trapped Gene
Mrps24 (ENSMUSG00000020477)
Vector Insertion
Chr 11: 5604736 - 5607300
Public Clones (sanger) (sanger) (sanger) CMHD-GT_470A3-3 (cmhd) CMHD-GT_268H7-3 (cmhd)
IST12168H6 (tigm) IST14313F8 (tigm) IST13527B10 (tigm) IST10915A10 (tigm)
Private Clones OST436604 (lexicon) OST436597 (lexicon) OST361188 (lexicon) OST316000 (lexicon)
OST309201 (lexicon) OST264782 (lexicon) OST264042 (lexicon) OST248433 (lexicon)
OST248431 (lexicon) OST247408 (lexicon) OST111594 (lexicon) OST79504 (lexicon)
OST45363 (lexicon) OST31208 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105217 (Chr11:5607301..5607412 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105217 (Chr11:5607301..5607412 -)
Downstram Exon
ENSMUSE00000266052 (Chr11:5604329..5604735 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379072 Chr11:5607627..5607690 No primer for this exon
upstream ENSMUSE00000105219 Chr11:5607490..5607558 No primer for this exon
upstream ENSMUSE00000105217 Chr11:5607301..5607412 No primer for this exon

*** Putative Vector Insertion (Chr 11: 5604736 - 5607300) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000266052 Chr11:5604329..5604735 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTACATCGCACACCGAAA Chr11:5607322..5607342 60.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTACATCGCACACCGAAA Chr11:5607322..5607342 60.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTAATCGCCTTGCAGCACAT Chr11:5604343..5604363 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCCTGTTCTCTGAGGTGGAG Chr11:5604373..5604393 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020477