Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13789
Trapped Gene
Jagn1 (ENSMUSG00000051256)
Vector Insertion
Chr 6: 113392792 - 113397251
Public Clones CMHD-GT_253D1-3 (cmhd)
Private Clones OST449140 (lexicon) OST142323 (lexicon) OST38408 (lexicon) OST32222 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000332206 (Chr6:113392703..113392791 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCATGCACTACCAGATGAG Chr6:113392772..113392791 59.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000332206 (Chr6:113392703..113392791 +)
Downstram Exon
ENSMUSE00000652394 (Chr6:113397252..113398203 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCATGCACTACCAGATGAG Chr6:113392772..113392791 59.27 55 AGTCTGGACAGCTCCCTTCA Chr6:113397793..113397812 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332206 Chr6:113392703..113392791 GCCATGCACTACCAGATGAG Chr6:113392772..113392791 59.27 55

*** Putative Vector Insertion (Chr 6: 113392792 - 113397251) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000652394 Chr6:113397252..113398203 AGTCTGGACAGCTCCCTTCA Chr6:113397793..113397812 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATAATCGCCTTGCAGCACA Chr6:113392841..113392861 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGACGTGACTGGGAAAAC Chr6:113392838..113392858 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051256