Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13793
Trapped Gene
1810020D17Rik (ENSMUSG00000035642)
Vector Insertion
Chr 7: 104699252 - 104706640
Public Clones CMHD-GT_250F9-3 (cmhd)
Private Clones OST438279 (lexicon) OST371812 (lexicon) OST358730 (lexicon) OST352001 (lexicon)
OST346395 (lexicon) OST341043 (lexicon) OST340154 (lexicon) OST235802 (lexicon)
OST173905 (lexicon) OST162125 (lexicon) OST119796 (lexicon) OST119051 (lexicon)
OST118028 (lexicon) OST118014 (lexicon) OST117573 (lexicon) OST31359 (lexicon)
OST27995 (lexicon) OST27273 (lexicon) OST25670 (lexicon) OST24176 (lexicon)
OST24116 (lexicon) OST23993 (lexicon) OST22323 (lexicon) OST17745 (lexicon)
OST12173 (lexicon) OST11126 (lexicon) OST7534 (lexicon) OST7010 (lexicon)
OST6618 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000443894 (Chr7:104706641..104706736 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAGCCAGCAGATGTAAAG Chr7:104706704..104706723 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000443894 (Chr7:104706641..104706736 -)
Downstram Exon
ENSMUSE00000270136 (Chr7:104698853..104699251 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAGCCAGCAGATGTAAAG Chr7:104706704..104706723 60.16 50 CAACCTGGAGTGCAAAACCT Chr7:104698938..104698957 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590611 Chr7:104727876..104727962 GATCCGACTGGAGGAACAAC Chr7:104727894..104727913 59.51 55
upstream ENSMUSE00000715517 Chr7:104724098..104724201 TGAGGTTCCCTGAACTCCTC Chr7:104724137..104724156 59.23 55
upstream ENSMUSE00000717798 Chr7:104724098..104724201 TGAGGTTCCCTGAACTCCTC Chr7:104724137..104724156 59.23 55
upstream ENSMUSE00000483109 Chr7:104713661..104713810 ATGGCTTCCCCTAAAATTGC Chr7:104713773..104713792 60.28 45
upstream ENSMUSE00000443894 Chr7:104706641..104706736 TGCAGCCAGCAGATGTAAAG Chr7:104706704..104706723 60.16 50

*** Putative Vector Insertion (Chr 7: 104699252 - 104706640) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000270136 Chr7:104698853..104699251 CAACCTGGAGTGCAAAACCT Chr7:104698938..104698957 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAATGAGTGAGGCCTTGAA Chr7:104706640..104706660 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAATGAGTGAGGCCTTGAA Chr7:104706640..104706660 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035642