Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13799
Trapped Gene
Vmn2r25 (ENSMUSG00000072779)
Vector Insertion
Chr 6: 123778589 - 123789312
Public Clones CMHD-GT_250E1-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692142 (Chr6:123789313..123790122 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCAGAGTCCAGCTTCAG Chr6:123790072..123790091 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692142 (Chr6:123789313..123790122 -)
Downstram Exon
ENSMUSE00000692139 (Chr6:123778364..123778588 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCAGAGTCCAGCTTCAG Chr6:123790072..123790091 59.99 60 ACAAATTCGCCAACCTTCAC Chr6:123778415..123778434 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692145 Chr6:123802991..123803208 No primer for this exon
upstream ENSMUSE00000651612 Chr6:123801816..123802113 TCCATTCAGATCTCCCGAGT Chr6:123801841..123801860 59.61 50
upstream ENSMUSE00000692142 Chr6:123789313..123790122 GGACCAGAGTCCAGCTTCAG Chr6:123790072..123790091 59.99 60

*** Putative Vector Insertion (Chr 6: 123778589 - 123789312) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692139 Chr6:123778364..123778588 ACAAATTCGCCAACCTTCAC Chr6:123778415..123778434 59.98 45
downstream ENSMUSE00000692134 Chr6:123775286..123775409 CTGGACATGGGACACAATCA Chr6:123775288..123775307 60.38 50
downstream ENSMUSE00000651609 Chr6:123772832..123773724 ACATCCCAGTAAGCCAGCAC Chr6:123772882..123772901 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGCATTTAATCGCCTTGC Chr6:123780249..123780269 60.07 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGACTCTGGCTTGTCGTG Chr6:123780257..123780277 60.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072779