Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI138
Trapped Gene
Aatf (ENSMUSG00000018697)
Vector Insertion
Chr 11: 84286669 - 84323160
Public Clones GC0098 (tigem) GC0591 (tigem) XE509 (baygenomics) YTA370 (baygenomics)
RRD065 (baygenomics) W027C04 (ggtc) PST5615-NR (escells) PST1370-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000418295 (Chr11:84323161..84323298 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000418295 (Chr11:84323161..84323298 -)
Downstram Exon
ENSMUSE00000274729 (Chr11:84286554..84286668 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418348 Chr11:84326794..84327003 No primer for this exon
upstream ENSMUSE00000675528 Chr11:84325673..84325831 No primer for this exon
upstream ENSMUSE00000105897 Chr11:84325643..84325831 No primer for this exon
upstream ENSMUSE00000105896 Chr11:84324985..84325080 No primer for this exon
upstream ENSMUSE00000105895 Chr11:84323701..84323919 No primer for this exon
upstream ENSMUSE00000418295 Chr11:84323161..84323298 No primer for this exon

*** Putative Vector Insertion (Chr 11: 84286669 - 84323160) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274729 Chr11:84286554..84286668 No primer for this exon
downstream ENSMUSE00000274725 Chr11:84284590..84284788 No primer for this exon
downstream ENSMUSE00000274722 Chr11:84284066..84284230 No primer for this exon
downstream ENSMUSE00000105903 Chr11:84280963..84281046 No primer for this exon
downstream ENSMUSE00000105908 Chr11:84262622..84262689 No primer for this exon
downstream ENSMUSE00000105910 Chr11:84259129..84259209 No primer for this exon
downstream ENSMUSE00000105906 Chr11:84256068..84256139 No primer for this exon
downstream ENSMUSE00000274699 Chr11:84236358..84236521 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATTTGCCAGTGCTCTGAA Chr11:84311164..84311184 59 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr11:84311093..84311113 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAAAGTAATCGCCTTGCAG Chr11:84311234..84311254 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAGTTTTGTCCACCGTGACTG Chr11:84311240..84311261 60.06 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018697