Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13810
Trapped Gene
AL824707.7 (ENSMUSG00000081169)
Vector Insertion
Chr 4: 86273392 - 86275215
Public Clones CMHD-GT_239C5-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720666 (Chr4:86275216..86275495 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGCCAGAGGTGCCATAAC Chr4:86275467..86275486 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720666 (Chr4:86275216..86275495 -)
Downstram Exon
ENSMUSE00000716580 (Chr4:86273235..86273391 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGCCAGAGGTGCCATAAC Chr4:86275467..86275486 59.96 50 CTGGTGATAGGCCCTCAAGA Chr4:86273263..86273282 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719291 Chr4:86277123..86277155 TGTGGTGATGAGAGTGGTCAA Chr4:86277130..86277150 60.15 47.62
upstream ENSMUSE00000720666 Chr4:86275216..86275495 AATGCCAGAGGTGCCATAAC Chr4:86275467..86275486 59.96 50

*** Putative Vector Insertion (Chr 4: 86273392 - 86275215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000716580 Chr4:86273235..86273391 CTGGTGATAGGCCCTCAAGA Chr4:86273263..86273282 60.21 55
downstream ENSMUSE00000711741 Chr4:86272979..86273234 AAAGGGACCTACCAGCCAGT Chr4:86273129..86273148 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr4:86275147..86275167 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTCAGAAGGAGCTGGGTAA Chr4:86275210..86275231 59.48 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000081169