Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13814
Trapped Gene
1700112E06Rik (ENSMUSG00000063458)
Vector Insertion
Chr 14: 23648005 - 23875176
Public Clones CMHD-GT_238D7-3 (cmhd) CMHD-GT_183E12-3 (cmhd) CMHD-GT_225C1-3 (cmhd) CMHD-GT_431G5-3 (cmhd)
CMHD-GT_530H12-3 (cmhd) CMHD-GT_213F11-3 (cmhd) IST10719F6 (tigm) IST12252F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520101 (Chr14:23647911..23648004 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAACCAGCCCCAGTACAC Chr14:23647944..23647963 59.58 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520101 (Chr14:23647911..23648004 +)
Downstram Exon
ENSMUSE00000460741 (Chr14:23875177..23875256 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAACCAGCCCCAGTACAC Chr14:23647944..23647963 59.58 60 CGGATAAACCTGTTACCCTCTG Chr14:23875241..23875262 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462700 Chr14:22839101..22839130 GGCTCATGGTCAGTGGAACT Chr14:22839108..22839127 60.12 55
upstream ENSMUSE00000465702 Chr14:22846449..22846549 No primer for this exon
upstream ENSMUSE00000464798 Chr14:23397070..23397196 GTTACCCCACTTGCACACCT Chr14:23397157..23397176 59.89 55
upstream ENSMUSE00000467677 Chr14:23403628..23403767 CCCAATGAGCTGGTCAACTT Chr14:23403715..23403734 60.11 50
upstream ENSMUSE00000520862 Chr14:23415647..23415764 GCTTTGTTCTGCACAAGCTG Chr14:23415649..23415668 59.79 50
upstream ENSMUSE00000520101 Chr14:23647911..23648004 GAGAACCAGCCCCAGTACAC Chr14:23647944..23647963 59.58 60

*** Putative Vector Insertion (Chr 14: 23648005 - 23875176) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000460741 Chr14:23875177..23875256 CGGATAAACCTGTTACCCTCTG Chr14:23875241..23875262 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCTTCTAATCGCCTTGCAG Chr14:23792049..23792070 58.76 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCCAAGTATCATTTCAGG Chr14:23792008..23792028 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063458