Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13815
Trapped Gene
Tbca (ENSMUSG00000042043)
Vector Insertion
Chr 13: 95607150 - 95612604
Public Clones CMHD-GT_238C12-3 (cmhd)
Private Clones OST245675 (lexicon) OST244290 (lexicon) OST187680 (lexicon) OST97206 (lexicon)
OST699 (lexicon) OST696 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301686 (Chr13:95607063..95607149 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCGGTTAGAGGCTGCATA Chr13:95607108..95607127 61.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301686 (Chr13:95607063..95607149 +)
Downstram Exon
ENSMUSE00000452365 (Chr13:95612605..95612852 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCGGTTAGAGGCTGCATA Chr13:95607108..95607127 61.31 55 GACCCCAGGATTTAATGCAA Chr13:95612732..95612751 59.76 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000301703 Chr13:95558898..95558957 No primer for this exon
upstream ENSMUSE00000301695 Chr13:95602315..95602420 TGAAGGCTGAAGATGGAGAGA Chr13:95602380..95602400 60.08 47.62
upstream ENSMUSE00000301686 Chr13:95607063..95607149 CGTCGGTTAGAGGCTGCATA Chr13:95607108..95607127 61.31 55

*** Putative Vector Insertion (Chr 13: 95607150 - 95612604) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000452365 Chr13:95612605..95612852 GACCCCAGGATTTAATGCAA Chr13:95612732..95612751 59.76 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCCACTGTCCAGGTTTA Chr13:95610183..95610203 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCTAATACGTGACTGGGAAA Chr13:95610191..95610214 60.28 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042043