Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13817
Trapped Gene
Zdhhc11 (ENSMUSG00000069189)
Vector Insertion
Chr 13: 74129579 - 74130085
Public Clones CMHD-GT_238B9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000570255 (Chr13:74129487..74129578 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTTCGCCGAAGTCAAGT Chr13:74129516..74129535 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000570255 (Chr13:74129487..74129578 +)
Downstram Exon
ENSMUSE00000681107 (Chr13:74130086..74130288 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTTCGCCGAAGTCAAGT Chr13:74129516..74129535 59.62 50 TGGGCTGATACCTTGGTGTT Chr13:74130144..74130163 60.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681110 Chr13:74101310..74101377 TGAGCAAGAAGTGCTGTTCAA Chr13:74101344..74101364 59.77 42.86
upstream ENSMUSE00000570264 Chr13:74102798..74103019 AAGTTCCTACCACGCCCTCT Chr13:74102861..74102880 60.13 55
upstream ENSMUSE00000570263 Chr13:74111051..74111229 TACCATCGATCCAGCTGACA Chr13:74111101..74111120 60.22 50
upstream ENSMUSE00000570262 Chr13:74112005..74112106 TGCAAATGGCTGAACAACTG Chr13:74112066..74112085 60.84 45
upstream ENSMUSE00000570261 Chr13:74114603..74114727 TTCGCACGGATCCTCTCTAT Chr13:74114704..74114723 59.8 50
upstream ENSMUSE00000570260 Chr13:74116591..74116746 GCTATTGCCAGCTTCGTGAT Chr13:74116692..74116711 60.38 50
upstream ENSMUSE00000570258 Chr13:74120045..74120157 ATCCAGCAGAGGAGAAAGAGC Chr13:74120105..74120125 60.11 52.38
upstream ENSMUSE00000570256 Chr13:74122737..74122777 No primer for this exon
upstream ENSMUSE00000570255 Chr13:74129487..74129578 CTCTTTCGCCGAAGTCAAGT Chr13:74129516..74129535 59.62 50

*** Putative Vector Insertion (Chr 13: 74129579 - 74130085) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681107 Chr13:74130086..74130288 TGGGCTGATACCTTGGTGTT Chr13:74130144..74130163 60.38 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGCTGACTGGGCCTCTA Chr13:74129589..74129609 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTGCTGACTGGGCCTCTA Chr13:74129589..74129609 60.56 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069189