Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13823
Trapped Gene
1190007I07Rik (ENSMUSG00000063320)
Vector Insertion
Chr 10: 82085570 - 82085709
Public Clones CMHD-GT_237A4-3 (cmhd)
Private Clones OST416342 (lexicon) OST388926 (lexicon) OST284943 (lexicon) OST270499 (lexicon)
OST257993 (lexicon) OST112899 (lexicon) OST112803 (lexicon) OST52135 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000574489 (Chr10:82085710..82085856 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGTCGTGGGAAGGAACGAG Chr10:82085800..82085819 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000574489 (Chr10:82085710..82085856 -)
Downstram Exon
ENSMUSE00000471887 (Chr10:82085453..82085569 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGTCGTGGGAAGGAACGAG Chr10:82085800..82085819 60.25 55 GGTCAGGCCGATAGTACCAA Chr10:82085433..82085452 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000574489 Chr10:82085710..82085856 TAGTCGTGGGAAGGAACGAG Chr10:82085800..82085819 60.25 55

*** Putative Vector Insertion (Chr 10: 82085570 - 82085709) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471887 Chr10:82085453..82085569 GGTCAGGCCGATAGTACCAA Chr10:82085433..82085452 59.96 55
downstream ENSMUSE00000472757 Chr10:82082603..82082962 GTTCGTGGCGTCTCTCTTTC Chr10:82082865..82082884 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTAATCGCCTTGCAGCAC Chr10:82085641..82085661 62.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTCGTGACTGGGAAAACC Chr10:82085642..82085662 61.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063320