Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13825
Trapped Gene
A930021C24Rik (ENSMUSG00000042655)
Vector Insertion
Chr 13: 105636144 - 105648368
Public Clones CMHD-GT_230C3-3 (cmhd)
Private Clones OST12683 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000312357 (Chr13:105648369..105648526 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGCTGCCCTTGTCTTACTT Chr13:105648481..105648500 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000312357 (Chr13:105648369..105648526 -)
Downstram Exon
ENSMUSE00000312351 (Chr13:105635363..105636143 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGCTGCCCTTGTCTTACTT Chr13:105648481..105648500 60.01 50 TTGTCTCTCCATCGTTGCTG Chr13:105635533..105635552 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000312365 Chr13:105653603..105653973 GGCTTCGCAGACCTCAAGTA Chr13:105653663..105653682 60.54 55
upstream ENSMUSE00000312357 Chr13:105648369..105648526 TCGCTGCCCTTGTCTTACTT Chr13:105648481..105648500 60.01 50

*** Putative Vector Insertion (Chr 13: 105636144 - 105648368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000312351 Chr13:105635363..105636143 TTGTCTCTCCATCGTTGCTG Chr13:105635533..105635552 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACAATTTCCCAACCTCTAACG Chr13:105645365..105645387 59.87 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAACCTCTAACGGCTTTAAAAT Chr13:105645355..105645378 59.92 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042655