Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13828
Trapped Gene
Ppil6 (ENSMUSG00000078451)
Vector Insertion
Chr 10: 41227366 - 41233896
Public Clones CMHD-GT_229D6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666462 (Chr10:41227230..41227365 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATAAGGGCCATCACACCAA Chr10:41227280..41227299 60.19 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666462 (Chr10:41227230..41227365 +)
Downstram Exon
ENSMUSE00000666461 (Chr10:41233897..41234092 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATAAGGGCCATCACACCAA Chr10:41227280..41227299 60.19 45 TGCTTAAGAACGTGGGTTCC Chr10:41233932..41233951 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666469 Chr10:41210284..41210427 TGTCAAAGACCATCGCTGAG Chr10:41210408..41210427 59.98 50
upstream ENSMUSE00000666468 Chr10:41214325..41214420 GCTTGGGATCAGTTTCTGGA Chr10:41214388..41214407 60.19 50
upstream ENSMUSE00000666467 Chr10:41218168..41218356 ACTCCTGGGTAACGCATTTG Chr10:41218227..41218246 59.99 50
upstream ENSMUSE00000666466 Chr10:41221431..41221493 No primer for this exon
upstream ENSMUSE00000666465 Chr10:41221590..41221737 ATTGTGATGCATGTCCCAGA Chr10:41221594..41221613 59.92 45
upstream ENSMUSE00000666464 Chr10:41222802..41222858 CGGAGACGACGGAGAGTCTA Chr10:41222818..41222837 60.54 60
upstream ENSMUSE00000666462 Chr10:41227230..41227365 AATAAGGGCCATCACACCAA Chr10:41227280..41227299 60.19 45

*** Putative Vector Insertion (Chr 10: 41227366 - 41233896) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666461 Chr10:41233897..41234092 TGCTTAAGAACGTGGGTTCC Chr10:41233932..41233951 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCAGCTCCCTACTTGGAT Chr10:41233327..41233347 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCAGCTCCCTACTTGGAT Chr10:41233327..41233347 60.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078451