Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13829
Trapped Gene
Banf2 (ENSMUSG00000037307)
Vector Insertion
Chr 2: 143899502 - 143899714
Public Clones CMHD-GT_229C8-3 (cmhd) CMHD-GT_208F12-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682463 (Chr2:143899503..143899715 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGTGGATCATCTGCTGCT Chr2:143899559..143899578 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682463 (Chr2:143899503..143899715 +)
Downstram Exon
ENSMUSE00000348966 (Chr2:143899503..143899713 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGTGGATCATCTGCTGCT Chr2:143899559..143899578 60.38 55 AGCAGCAGATGATCCACCTC Chr2:143899581..143899600 60.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423017 Chr2:143858838..143858904 TGCTACTGCCTGACCAAGTG Chr2:143858879..143858898 60.05 55
upstream ENSMUSE00000422992 Chr2:143888033..143888151 TGACAGACAGGACCCTTGAA Chr2:143888040..143888059 59.23 50
upstream ENSMUSE00000251656 Chr2:143891141..143891269 CTTGCCATCAATTTGGTCAC Chr2:143891234..143891253 58.98 45
upstream ENSMUSE00000714197 Chr2:143891141..143891269 CTTGCCATCAATTTGGTCAC Chr2:143891234..143891253 58.98 45

*** Putative Vector Insertion (Chr 2: 143899502 - 143899714) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348966 Chr2:143899503..143899713 AGCAGCAGATGATCCACCTC Chr2:143899581..143899600 60.38 55
downstream ENSMUSE00000682463 Chr2:143899503..143899715 AGCAGCAGATGATCCACCTC Chr2:143899581..143899600 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCTGCTGGGACAGTTTCT Chr2:143899510..143899530 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGAATGAAGCAGCGTGA Chr2:143899538..143899558 59.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037307