Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13830
Trapped Gene
1500032L24Rik (ENSMUSG00000022452)
Vector Insertion
Chr 15: 82176700 - 82178329
Public Clones CMHD-GT_229B11-3 (cmhd) CMHD-GT_513E3-3 (cmhd) CMHD-GT_178B12-3 (cmhd) CMHD-GT_534C3-3 (cmhd)
Private Clones OST435862 (lexicon) OST315386 (lexicon) OST148895 (lexicon) OST114826 (lexicon)
OST62061 (lexicon) OST35757 (lexicon)
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406151 (Chr15:82176485..82176699 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGAGGTCAGTCATCGTCAC Chr15:82176646..82176665 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406151 (Chr15:82176485..82176699 +)
Downstram Exon
ENSMUSE00000127099 (Chr15:82178330..82178470 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGAGGTCAGTCATCGTCAC Chr15:82176646..82176665 59.83 55 CACTCGGAGAAGACCAAAGG Chr15:82178356..82178375 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406151 Chr15:82176485..82176699 TCGAGGTCAGTCATCGTCAC Chr15:82176646..82176665 59.83 55

*** Putative Vector Insertion (Chr 15: 82176700 - 82178329) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127099 Chr15:82178330..82178470 CACTCGGAGAAGACCAAAGG Chr15:82178356..82178375 59.84 55
downstream ENSMUSE00000347077 Chr15:82179273..82179492 GGGCTCTTGTCACAAACCAT Chr15:82179395..82179414 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCGGTGAAAGTGAGTGTCT Chr15:82176691..82176711 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGGTGAAAGTGAGTGTCT Chr15:82176691..82176711 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022452