Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13854
Trapped Gene
1700028P14Rik (ENSMUSG00000033053)
Vector Insertion
Chr 19: 23633528 - 23646974
Public Clones CMHD-GT_227B3-3 (cmhd)
Private Clones OST5654 (lexicon) OST5653 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249814 (Chr19:23646975..23647032 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249814 (Chr19:23646975..23647032 -)
Downstram Exon
ENSMUSE00000249783 (Chr19:23633250..23633527 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCATGTGTTGATGCCAAGTC Chr19:23633407..23633426 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000249934 Chr19:23727065..23727304 GCGGTGGTATGAGATTGGAC Chr19:23727150..23727169 60.35 55
upstream ENSMUSE00000249907 Chr19:23691009..23691114 TCTGGAGACGGTGAAAAACC Chr19:23691050..23691069 60.09 50
upstream ENSMUSE00000249857 Chr19:23667517..23667635 GTGAACAGATGGCCCAAGTT Chr19:23667597..23667616 59.97 50
upstream ENSMUSE00000249837 Chr19:23666599..23666667 GGCTTTCGGGATGTTCCTAT Chr19:23666626..23666645 60.29 50
upstream ENSMUSE00000249814 Chr19:23646975..23647032 No primer for this exon

*** Putative Vector Insertion (Chr 19: 23633528 - 23646974) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000249783 Chr19:23633250..23633527 CCATGTGTTGATGCCAAGTC Chr19:23633407..23633426 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr19:23634906..23634926 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAATGGGGTGAAACGTGAC Chr19:23634917..23634937 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033053