Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI13863
Trapped Gene
Fbxo36 (ENSMUSG00000073633)
Vector Insertion
Chr 1: 84877776 - 84893064
Public Clones CMHD-GT_219C2-3 (cmhd) CMHD-GT_509C6-3 (cmhd) CMHD-GT_171C3-3 (cmhd) (cmhd)
CMHD-GT_121C3-3 (cmhd) FHCRC-GT-S10-7D1 (fhcrc) IST11038F6BBF1 (tigm) IST10351F6 (tigm)
IST15054E6 (tigm) IST14460H9 (tigm) IST15092A10 (tigm) IST14630F8 (tigm)
IST12534D2 (tigm) IST10767H10 (tigm) IST14630F8 (tigm) IST10767H10 (tigm)
IST11322E6 (tigm) IST10921H11 (tigm) IST14254D2 (tigm) IST10207C9 (tigm)
IST12411C6 (tigm) IST12262F1 (tigm) IST10017A6BBR1 (tigm) IST15092A10 (tigm)
IST13271C2 (tigm) IST10142F6 (tigm) IST10606B4 (tigm) IST10447B7 (tigm)
IST14798B7 (tigm) IST11103H8 (tigm) IST12468H5 (tigm) IST12059G7 (tigm)
IST14752B7 (tigm) IST10207C9BBF1 (tigm) IST14887E3 (tigm) IST11038F6 (tigm)
IST10351F6 (tigm) IST12332F6 (tigm) IST12468H5 (tigm) IST12331H6 (tigm)
IST11631G9 (tigm) IST11093H8 (tigm) IST12331H6 (tigm) IST12059G7 (tigm)
IST12847B6 (tigm) IST11631G9 (tigm) IST11892D10 (tigm) IST10142F6 (tigm)
IST15054E6 (tigm) IST14421G11 (tigm)
Private Clones OST464907 (lexicon) OST464766 (lexicon) OST464365 (lexicon) OST463653 (lexicon)
OST456673 (lexicon) OST456472 (lexicon) OST455662 (lexicon) OST453540 (lexicon)
OST453464 (lexicon) OST450906 (lexicon) OST450156 (lexicon) OST449015 (lexicon)
OST448772 (lexicon) OST445277 (lexicon) OST443710 (lexicon) OST442087 (lexicon)
OST440611 (lexicon) OST439427 (lexicon) OST438337 (lexicon) OST437322 (lexicon)
OST435796 (lexicon) OST433862 (lexicon) OST433752 (lexicon) OST431353 (lexicon)
OST429499 (lexicon) OST425181 (lexicon) OST425177 (lexicon) OST425155 (lexicon)
OST418719 (lexicon) OST416739 (lexicon) OST416678 (lexicon) OST414370 (lexicon)
OST412178 (lexicon) OST405695 (lexicon) OST405590 (lexicon) OST404276 (lexicon)
OST403603 (lexicon) OST401073 (lexicon) OST390807 (lexicon) OST390496 (lexicon)
OST389171 (lexicon) OST388473 (lexicon) OST384987 (lexicon) OST378139 (lexicon)
OST377269 (lexicon) OST374595 (lexicon) OST368337 (lexicon) OST366578 (lexicon)
OST353753 (lexicon) OST353609 (lexicon) OST352087 (lexicon) OST351736 (lexicon)
OST347337 (lexicon) OST347264 (lexicon) OST346999 (lexicon) OST346377 (lexicon)
OST346007 (lexicon) OST345875 (lexicon) OST339308 (lexicon) OST335368 (lexicon)
OST334911 (lexicon) OST333335 (lexicon) OST330966 (lexicon) OST326366 (lexicon)
OST321695 (lexicon) OST319690 (lexicon) OST319242 (lexicon) OST315683 (lexicon)
OST315109 (lexicon) OST314334 (lexicon) OST309217 (lexicon) OST309186 (lexicon)
OST307867 (lexicon) OST307043 (lexicon) OST306547 (lexicon) OST299230 (lexicon)
OST292963 (lexicon) OST291382 (lexicon) OST290823 (lexicon) OST290050 (lexicon)
OST289130 (lexicon) OST288545 (lexicon) OST288514 (lexicon) OST286374 (lexicon)
OST285388 (lexicon) OST285191 (lexicon) OST283044 (lexicon) OST281406 (lexicon)
OST280127 (lexicon) OST278142 (lexicon) OST277050 (lexicon) OST275293 (lexicon)
OST274292 (lexicon) OST271115 (lexicon) OST270596 (lexicon) OST269798 (lexicon)
OST261569 (lexicon) OST256822 (lexicon) OST255983 (lexicon) OST255003 (lexicon)
OST254655 (lexicon) OST251741 (lexicon) OST247921 (lexicon) OST246808 (lexicon)
OST245480 (lexicon) OST244737 (lexicon) OST244694 (lexicon) OST242828 (lexicon)
OST240021 (lexicon) OST235597 (lexicon) OST233247 (lexicon) OST231402 (lexicon)
OST226031 (lexicon) OST214761 (lexicon) OST213035 (lexicon) OST211146 (lexicon)
OST209322 (lexicon) OST209276 (lexicon) OST208768 (lexicon) OST207416 (lexicon)
OST207228 (lexicon) OST207138 (lexicon) OST206783 (lexicon) OST205949 (lexicon)
OST204076 (lexicon) OST203322 (lexicon) OST201888 (lexicon) OST199655 (lexicon)
OST197720 (lexicon) OST195063 (lexicon) OST192379 (lexicon) OST190842 (lexicon)
OST189085 (lexicon) OST188893 (lexicon) OST184428 (lexicon) OST183846 (lexicon)
OST183811 (lexicon) OST182518 (lexicon) OST182366 (lexicon) OST181812 (lexicon)
OST179058 (lexicon) OST177585 (lexicon) OST176800 (lexicon) OST176087 (lexicon)
OST175526 (lexicon) OST172602 (lexicon) OST168775 (lexicon) OST168410 (lexicon)
OST167374 (lexicon) OST159247 (lexicon) OST152219 (lexicon) OST148118 (lexicon)
OST142142 (lexicon) OST141638 (lexicon) OST139489 (lexicon) OST137022 (lexicon)
OST132447 (lexicon) OST129089 (lexicon) OST126573 (lexicon) OST125093 (lexicon)
OST113447 (lexicon) OST100421 (lexicon) OST99900 (lexicon) OST98199 (lexicon)
OST95901 (lexicon) OST83721 (lexicon) OST79789 (lexicon) OST78844 (lexicon)
OST74364 (lexicon) OST68884 (lexicon) OST65371 (lexicon) OST63306 (lexicon)
OST61470 (lexicon) OST59108 (lexicon) OST58023 (lexicon) OST54434 (lexicon)
OST48272 (lexicon) OST43064 (lexicon) OST31808 (lexicon) OST31530 (lexicon)
OST27912 (lexicon) OST27236 (lexicon) OST25472 (lexicon) OST23972 (lexicon)
OST21690 (lexicon) OST20708 (lexicon) OST17162 (lexicon) OST15944 (lexicon)
OST8467 (lexicon) OST8444 (lexicon) OST8329 (lexicon) OST7276 (lexicon)
OST6937 (lexicon) OST6754 (lexicon) OST6057 (lexicon) OST5678 (lexicon)
OST5604 (lexicon) OST372 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000629370 (Chr1:84877667..84877775 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGTATCGGTCAGCAAAACC Chr1:84877702..84877722 60.12 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000629370 (Chr1:84877667..84877775 +)
Downstram Exon
ENSMUSE00000629369 (Chr1:84893065..84893237 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGTATCGGTCAGCAAAACC Chr1:84877702..84877722 60.12 47.62 CTTCGCACAGGTTGAAGACA Chr1:84893127..84893146 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000629372 Chr1:84836420..84836543 GTTGTTGATCACCCGGACTC Chr1:84836522..84836541 60.37 55
upstream ENSMUSE00000629370 Chr1:84877667..84877775 TGAGTATCGGTCAGCAAAACC Chr1:84877702..84877722 60.12 47.62

*** Putative Vector Insertion (Chr 1: 84877776 - 84893064) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000629369 Chr1:84893065..84893237 CTTCGCACAGGTTGAAGACA Chr1:84893127..84893146 60.03 50
downstream ENSMUSE00000629368 Chr1:84896572..84897059 TAGTACTTGGGCCCTGGTTG Chr1:84896952..84896971 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACTGCTAATCGCCTTGC Chr1:84877819..84877839 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCTGAGACACTGCTGGT Chr1:84892780..84892800 59.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073633